\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0131504952:

Variant ID: vg0131504952 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 31504952
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 39. )

Flanking Sequence (100 bp) in Reference Genome:


ACCGCAACTTCCATTGGTGTTCGAGAGATAATTCTACTCGTTCGCTGGTTTCCGAACCAGTACGTAGCAATCTCTCGCACCGCAAACTTCCATTGGTGTT[T/C]
GAGAGATAATTCTACTCGCTCGCTGGTTCTCAAACCAGTATGTAGCAATCTCTCGCACCGCAACTTCCATTGGTGTCCAAGAGATAATTCTACTCGCTCG

Reverse complement sequence

CGAGCGAGTAGAATTATCTCTTGGACACCAATGGAAGTTGCGGTGCGAGAGATTGCTACATACTGGTTTGAGAACCAGCGAGCGAGTAGAATTATCTCTC[A/G]
AACACCAATGGAAGTTTGCGGTGCGAGAGATTGCTACGTACTGGTTCGGAAACCAGCGAACGAGTAGAATTATCTCTCGAACACCAATGGAAGTTGCGGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.40% 4.40% 5.73% 26.43% NA
All Indica  2759 54.90% 0.70% 6.71% 37.69% NA
All Japonica  1512 83.60% 12.20% 3.97% 0.20% NA
Aus  269 15.60% 0.00% 8.92% 75.46% NA
Indica I  595 49.90% 0.30% 2.52% 47.23% NA
Indica II  465 95.10% 0.90% 0.43% 3.66% NA
Indica III  913 35.00% 1.00% 14.35% 49.62% NA
Indica Intermediate  786 58.10% 0.40% 4.71% 36.77% NA
Temperate Japonica  767 88.30% 6.60% 5.08% 0.00% NA
Tropical Japonica  504 90.30% 6.20% 3.37% 0.20% NA
Japonica Intermediate  241 54.80% 42.70% 1.66% 0.83% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 5.60% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0131504952 T -> DEL N N silent_mutation Average:24.023; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0131504952 T -> C LOC_Os01g54770.1 upstream_gene_variant ; 3690.0bp to feature; MODIFIER silent_mutation Average:24.023; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0131504952 T -> C LOC_Os01g54750.1 downstream_gene_variant ; 1979.0bp to feature; MODIFIER silent_mutation Average:24.023; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg0131504952 T -> C LOC_Os01g54760.1 intron_variant ; MODIFIER silent_mutation Average:24.023; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0131504952 NA 2.72E-06 mr1755 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131504952 NA 8.49E-08 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131504952 NA 3.66E-07 mr1045_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131504952 NA 4.05E-07 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131504952 NA 9.88E-06 mr1207_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131504952 NA 7.75E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131504952 NA 6.06E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131504952 NA 7.71E-07 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131504952 NA 1.66E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131504952 NA 1.11E-06 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131504952 NA 4.24E-06 mr1681_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131504952 NA 5.67E-11 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131504952 NA 5.84E-10 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131504952 NA 9.08E-06 mr1767_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131504952 NA 1.83E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131504952 NA 5.74E-06 mr1854_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131504952 NA 2.86E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131504952 NA 4.01E-07 mr1906_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131504952 NA 3.32E-06 mr1909_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131504952 NA 4.88E-06 mr1924_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131504952 NA 5.96E-08 mr1960_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251