| Variant ID: vg0131504924 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 31504924 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CTCGAACCAGTACGTAGCAATCTCTCGCACCGCAACTTCCATTGGTGTTCGAGAGATAATTCTACTCGTTCGCTGGTTTCCGAACCAGTACGTAGCAATC[T/G]
CTCGCACCGCAAACTTCCATTGGTGTTTGAGAGATAATTCTACTCGCTCGCTGGTTCTCAAACCAGTATGTAGCAATCTCTCGCACCGCAACTTCCATTG
CAATGGAAGTTGCGGTGCGAGAGATTGCTACATACTGGTTTGAGAACCAGCGAGCGAGTAGAATTATCTCTCAAACACCAATGGAAGTTTGCGGTGCGAG[A/C]
GATTGCTACGTACTGGTTCGGAAACCAGCGAACGAGTAGAATTATCTCTCGAACACCAATGGAAGTTGCGGTGCGAGAGATTGCTACGTACTGGTTCGAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.10% | 1.90% | 6.35% | 8.57% | NA |
| All Indica | 2759 | 78.50% | 2.30% | 5.11% | 14.10% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 25.70% | 9.70% | 58.74% | 5.95% | NA |
| Indica I | 595 | 96.00% | 0.00% | 2.35% | 1.68% | NA |
| Indica II | 465 | 96.30% | 0.60% | 1.29% | 1.72% | NA |
| Indica III | 913 | 56.60% | 4.90% | 8.00% | 30.45% | NA |
| Indica Intermediate | 786 | 80.00% | 2.00% | 6.11% | 11.83% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0131504924 | T -> G | LOC_Os01g54770.1 | upstream_gene_variant ; 3718.0bp to feature; MODIFIER | silent_mutation | Average:23.792; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0131504924 | T -> G | LOC_Os01g54750.1 | downstream_gene_variant ; 1951.0bp to feature; MODIFIER | silent_mutation | Average:23.792; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0131504924 | T -> G | LOC_Os01g54760.1 | intron_variant ; MODIFIER | silent_mutation | Average:23.792; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0131504924 | T -> DEL | N | N | silent_mutation | Average:23.792; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0131504924 | NA | 4.59E-06 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131504924 | NA | 2.22E-06 | mr1523 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131504924 | 7.11E-06 | 7.32E-07 | mr1677 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131504924 | NA | 4.21E-06 | mr1973 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131504924 | 2.51E-06 | NA | mr1723_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131504924 | NA | 4.46E-06 | mr1723_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |