\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0131503760:

Variant ID: vg0131503760 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 31503760
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.03, others allele: 0.00, population size: 28. )

Flanking Sequence (100 bp) in Reference Genome:


TGGTGTGATTATGGTGAATAAGAGCAATACCGGCTTTGGCCAACAGGATGTAGGGTTATTGCCTGACAATTCAGGGGCCCGAACCTATATAAAAATCCCT[G/A]
TGTCCGTCTCTTTTACCTCAGTCCCGCGTATATCCTAGTACCAACGATCCCCATACTATGCAAATACCGGAATCGTGACATCAAACGTCGACAGTGGCGC

Reverse complement sequence

GCGCCACTGTCGACGTTTGATGTCACGATTCCGGTATTTGCATAGTATGGGGATCGTTGGTACTAGGATATACGCGGGACTGAGGTAAAAGAGACGGACA[C/T]
AGGGATTTTTATATAGGTTCGGGCCCCTGAATTGTCAGGCAATAACCCTACATCCTGTTGGCCAAAGCCGGTATTGCTCTTATTCACCATAATCACACCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.60% 17.40% 0.00% 0.00% NA
All Indica  2759 78.10% 21.90% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 20.40% 79.60% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 55.90% 44.10% 0.00% 0.00% NA
Indica Intermediate  786 79.60% 20.40% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0131503760 G -> A LOC_Os01g54760.1 upstream_gene_variant ; 221.0bp to feature; MODIFIER silent_mutation Average:38.5; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0131503760 G -> A LOC_Os01g54770.1 upstream_gene_variant ; 4882.0bp to feature; MODIFIER silent_mutation Average:38.5; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0131503760 G -> A LOC_Os01g54750.1 downstream_gene_variant ; 787.0bp to feature; MODIFIER silent_mutation Average:38.5; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg0131503760 G -> A LOC_Os01g54750-LOC_Os01g54760 intergenic_region ; MODIFIER silent_mutation Average:38.5; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0131503760 NA 5.67E-06 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131503760 NA 5.30E-07 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131503760 NA 3.14E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131503760 NA 2.47E-06 mr1523 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131503760 NA 5.39E-06 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131503760 1.41E-06 2.87E-07 mr1677 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131503760 NA 4.48E-07 mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131503760 NA 1.25E-14 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131503760 3.85E-06 3.85E-06 mr1964 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131503760 NA 3.80E-06 mr1972 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131503760 1.48E-06 1.48E-06 mr1972 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131503760 NA 8.84E-07 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251