\
| Variant ID: vg0131503760 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 31503760 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.03, others allele: 0.00, population size: 28. )
TGGTGTGATTATGGTGAATAAGAGCAATACCGGCTTTGGCCAACAGGATGTAGGGTTATTGCCTGACAATTCAGGGGCCCGAACCTATATAAAAATCCCT[G/A]
TGTCCGTCTCTTTTACCTCAGTCCCGCGTATATCCTAGTACCAACGATCCCCATACTATGCAAATACCGGAATCGTGACATCAAACGTCGACAGTGGCGC
GCGCCACTGTCGACGTTTGATGTCACGATTCCGGTATTTGCATAGTATGGGGATCGTTGGTACTAGGATATACGCGGGACTGAGGTAAAAGAGACGGACA[C/T]
AGGGATTTTTATATAGGTTCGGGCCCCTGAATTGTCAGGCAATAACCCTACATCCTGTTGGCCAAAGCCGGTATTGCTCTTATTCACCATAATCACACCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.60% | 17.40% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 20.40% | 79.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 55.90% | 44.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 79.60% | 20.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0131503760 | G -> A | LOC_Os01g54760.1 | upstream_gene_variant ; 221.0bp to feature; MODIFIER | silent_mutation | Average:38.5; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0131503760 | G -> A | LOC_Os01g54770.1 | upstream_gene_variant ; 4882.0bp to feature; MODIFIER | silent_mutation | Average:38.5; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0131503760 | G -> A | LOC_Os01g54750.1 | downstream_gene_variant ; 787.0bp to feature; MODIFIER | silent_mutation | Average:38.5; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| vg0131503760 | G -> A | LOC_Os01g54750-LOC_Os01g54760 | intergenic_region ; MODIFIER | silent_mutation | Average:38.5; most accessible tissue: Zhenshan97 panicle, score: 68.538 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0131503760 | NA | 5.67E-06 | mr1054 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131503760 | NA | 5.30E-07 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131503760 | NA | 3.14E-07 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131503760 | NA | 2.47E-06 | mr1523 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131503760 | NA | 5.39E-06 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131503760 | 1.41E-06 | 2.87E-07 | mr1677 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131503760 | NA | 4.48E-07 | mr1777 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131503760 | NA | 1.25E-14 | mr1897 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131503760 | 3.85E-06 | 3.85E-06 | mr1964 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131503760 | NA | 3.80E-06 | mr1972 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131503760 | 1.48E-06 | 1.48E-06 | mr1972 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131503760 | NA | 8.84E-07 | mr1723_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |