Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0131503760:

Variant ID: vg0131503760 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 31503760
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.03, others allele: 0.00, population size: 28. )

Flanking Sequence (100 bp) in Reference Genome:

TGGTGTGATTATGGTGAATAAGAGCAATACCGGCTTTGGCCAACAGGATGTAGGGTTATTGCCTGACAATTCAGGGGCCCGAACCTATATAAAAATCCCT[G/A]
TGTCCGTCTCTTTTACCTCAGTCCCGCGTATATCCTAGTACCAACGATCCCCATACTATGCAAATACCGGAATCGTGACATCAAACGTCGACAGTGGCGC

Reverse complement sequence

GCGCCACTGTCGACGTTTGATGTCACGATTCCGGTATTTGCATAGTATGGGGATCGTTGGTACTAGGATATACGCGGGACTGAGGTAAAAGAGACGGACA[C/T]
AGGGATTTTTATATAGGTTCGGGCCCCTGAATTGTCAGGCAATAACCCTACATCCTGTTGGCCAAAGCCGGTATTGCTCTTATTCACCATAATCACACCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.60%	17.40%	0.00%	0.00%	NA
All Indica	2759	78.10%	21.90%	0.00%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	20.40%	79.60%	0.00%	0.00%	NA
Indica I	595	96.10%	3.90%	0.00%	0.00%	NA
Indica II	465	96.10%	3.90%	0.00%	0.00%	NA
Indica III	913	55.90%	44.10%	0.00%	0.00%	NA
Indica Intermediate	786	79.60%	20.40%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0131503760	G -> A	LOC_Os01g54760.1	upstream_gene_variant ; 221.0bp to feature; MODIFIER	silent_mutation	Average:38.5; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0131503760	G -> A	LOC_Os01g54770.1	upstream_gene_variant ; 4882.0bp to feature; MODIFIER	silent_mutation	Average:38.5; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0131503760	G -> A	LOC_Os01g54750.1	downstream_gene_variant ; 787.0bp to feature; MODIFIER	silent_mutation	Average:38.5; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg0131503760	G -> A	LOC_Os01g54750-LOC_Os01g54760	intergenic_region ; MODIFIER	silent_mutation	Average:38.5; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0131503760	NA	5.67E-06	mr1054	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131503760	NA	5.30E-07	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131503760	NA	3.14E-07	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131503760	NA	2.47E-06	mr1523	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131503760	NA	5.39E-06	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131503760	1.41E-06	2.87E-07	mr1677	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131503760	NA	4.48E-07	mr1777	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131503760	NA	1.25E-14	mr1897	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131503760	3.85E-06	3.85E-06	mr1964	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131503760	NA	3.80E-06	mr1972	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131503760	1.48E-06	1.48E-06	mr1972	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131503760	NA	8.84E-07	mr1723_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251