\
| Variant ID: vg0131435897 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 31435897 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 126. )
CTGCAGTTAAGCCATTTAGCGGATTTGCAAAAATTGAACATAAACTTGCCAATATCATAATAAATTCGTGACAACATCAGAGATTCAAAATAGTTCAAAA[C/T]
ACTTCAATTCTTCAACACTCGACAACATCAAAGCAAGAAATCCTACCTGCCTCTGACTCCGCTAGGACATGGTGCCTGCCGTTCGAGCTTGGTGCCTTGG
CCAAGGCACCAAGCTCGAACGGCAGGCACCATGTCCTAGCGGAGTCAGAGGCAGGTAGGATTTCTTGCTTTGATGTTGTCGAGTGTTGAAGAATTGAAGT[G/A]
TTTTGAACTATTTTGAATCTCTGATGTTGTCACGAATTTATTATGATATTGGCAAGTTTATGTTCAATTTTTGCAAATCCGCTAAATGGCTTAACTGCAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.60% | 12.40% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 78.70% | 21.20% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.00% | 2.80% | 0.22% | 0.00% | NA |
| Indica III | 913 | 56.50% | 43.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 80.80% | 19.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0131435897 | C -> T | LOC_Os01g54630.1 | upstream_gene_variant ; 2695.0bp to feature; MODIFIER | silent_mutation | Average:29.999; most accessible tissue: Zhenshan97 flag leaf, score: 39.027 | N | N | N | N |
| vg0131435897 | C -> T | LOC_Os01g54650.1 | upstream_gene_variant ; 4475.0bp to feature; MODIFIER | silent_mutation | Average:29.999; most accessible tissue: Zhenshan97 flag leaf, score: 39.027 | N | N | N | N |
| vg0131435897 | C -> T | LOC_Os01g54640.1 | intron_variant ; MODIFIER | silent_mutation | Average:29.999; most accessible tissue: Zhenshan97 flag leaf, score: 39.027 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0131435897 | 6.08E-06 | 1.30E-06 | mr1392 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131435897 | NA | 1.35E-06 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131435897 | 7.74E-06 | 7.37E-07 | mr1677 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131435897 | 3.01E-06 | 3.01E-06 | mr1972 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131435897 | NA | 1.89E-06 | mr1723_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |