Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0131361719:

Variant ID: vg0131361719 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 31361719
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GGTAGGTGGCGACGGGCTAGGTCCCGCAACGGCCGGCGGTGGGTGACAAGGGGATGGTGGGAGGCTTGGGCTTGGCTCGTGGTGGATGGCAGTGGGCGAC[A/G]
GGTGGCTTGGGCTTCCTAAGGGCGGGCTCGACCCACAACTACTGACGGCGGGTGCCTCGGTGGCCGAATCCACCTCCGCCGATCTCGTGACGGCGCGATC

Reverse complement sequence

GATCGCGCCGTCACGAGATCGGCGGAGGTGGATTCGGCCACCGAGGCACCCGCCGTCAGTAGTTGTGGGTCGAGCCCGCCCTTAGGAAGCCCAAGCCACC[T/C]
GTCGCCCACTGCCATCCACCACGAGCCAAGCCCAAGCCTCCCACCATCCCCTTGTCACCCACCGCCGGCCGTTGCGGGACCTAGCCCGTCGCCACCTACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.80% 18.60% 1.57% 0.00% NA
All Indica  2759 98.30% 1.60% 0.11% 0.00% NA
All Japonica  1512 47.20% 48.60% 4.17% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.80% 3.00% 0.17% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 96.80% 3.10% 0.13% 0.00% NA
Temperate Japonica  767 19.70% 74.20% 6.13% 0.00% NA
Tropical Japonica  504 82.30% 15.50% 2.18% 0.00% NA
Japonica Intermediate  241 61.40% 36.50% 2.07% 0.00% NA
VI/Aromatic  96 24.00% 74.00% 2.08% 0.00% NA
Intermediate  90 60.00% 33.30% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0131361719 A -> G LOC_Os01g54520.1 3_prime_UTR_variant ; 1614.0bp to feature; MODIFIER silent_mutation Average:85.271; most accessible tissue: Minghui63 young leaf, score: 90.802 N N N N
vg0131361719 A -> G LOC_Os01g54530.1 upstream_gene_variant ; 915.0bp to feature; MODIFIER silent_mutation Average:85.271; most accessible tissue: Minghui63 young leaf, score: 90.802 N N N N
vg0131361719 A -> G LOC_Os01g54515.1 downstream_gene_variant ; 2771.0bp to feature; MODIFIER silent_mutation Average:85.271; most accessible tissue: Minghui63 young leaf, score: 90.802 N N N N
vg0131361719 A -> G LOC_Os01g54520.2 downstream_gene_variant ; 1012.0bp to feature; MODIFIER silent_mutation Average:85.271; most accessible tissue: Minghui63 young leaf, score: 90.802 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0131361719 A G -0.01 -0.02 -0.01 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0131361719 NA 5.19E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131361719 NA 1.26E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131361719 NA 5.22E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131361719 NA 1.52E-07 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131361719 NA 2.20E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131361719 NA 1.01E-07 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131361719 NA 3.33E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131361719 NA 8.02E-06 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131361719 NA 1.82E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131361719 NA 3.32E-06 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131361719 4.72E-06 4.72E-06 mr1811_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131361719 NA 3.20E-06 mr1816_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131361719 NA 2.55E-06 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131361719 NA 5.27E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131361719 NA 3.19E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251