\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0131152445:

Variant ID: vg0131152445 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 31152445
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTGGTTATGGTTTTCTTCTAATTACCCTTGCAGCACATAAATTCTAAAGTAAAATTACTTGAAACTGTATAGTTTTCAATTTATAAGAAAATATTATGT[C/T]
GAAACAATAGATGTAGTTTCTATGAGAAAATTTTGAGTATTTCGACTCCCCACGGGGATATCTTATCCCTGCCAAAAAGTCCAATTTTTCTGTTACATTC

Reverse complement sequence

GAATGTAACAGAAAAATTGGACTTTTTGGCAGGGATAAGATATCCCCGTGGGGAGTCGAAATACTCAAAATTTTCTCATAGAAACTACATCTATTGTTTC[G/A]
ACATAATATTTTCTTATAAATTGAAAACTATACAGTTTCAAGTAATTTTACTTTAGAATTTATGTGCTGCAAGGGTAATTAGAAGAAAACCATAACCAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.00% 7.30% 0.66% 1.02% NA
All Indica  2759 84.70% 12.50% 1.12% 1.74% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.80% 4.00% 0.17% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 70.20% 23.00% 2.41% 4.38% NA
Indica Intermediate  786 84.20% 13.90% 0.89% 1.02% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0131152445 C -> T LOC_Os01g54160.1 upstream_gene_variant ; 1513.0bp to feature; MODIFIER silent_mutation Average:40.823; most accessible tissue: Callus, score: 65.729 N N N N
vg0131152445 C -> T LOC_Os01g54170.1 downstream_gene_variant ; 4948.0bp to feature; MODIFIER silent_mutation Average:40.823; most accessible tissue: Callus, score: 65.729 N N N N
vg0131152445 C -> T LOC_Os01g54160-LOC_Os01g54170 intergenic_region ; MODIFIER silent_mutation Average:40.823; most accessible tissue: Callus, score: 65.729 N N N N
vg0131152445 C -> DEL N N silent_mutation Average:40.823; most accessible tissue: Callus, score: 65.729 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0131152445 NA 9.44E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131152445 NA 6.82E-07 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131152445 1.44E-06 NA mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131152445 2.45E-06 2.45E-06 mr1275 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131152445 6.35E-06 NA mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131152445 1.65E-06 1.65E-06 mr1345 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131152445 4.68E-06 4.79E-07 mr1427 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131152445 NA 1.01E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131152445 8.21E-06 6.70E-08 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131152445 NA 3.30E-06 mr1678 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131152445 NA 5.70E-06 mr1678 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131152445 3.03E-06 3.03E-06 mr1777 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251