\
| Variant ID: vg0131152445 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 31152445 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATTGGTTATGGTTTTCTTCTAATTACCCTTGCAGCACATAAATTCTAAAGTAAAATTACTTGAAACTGTATAGTTTTCAATTTATAAGAAAATATTATGT[C/T]
GAAACAATAGATGTAGTTTCTATGAGAAAATTTTGAGTATTTCGACTCCCCACGGGGATATCTTATCCCTGCCAAAAAGTCCAATTTTTCTGTTACATTC
GAATGTAACAGAAAAATTGGACTTTTTGGCAGGGATAAGATATCCCCGTGGGGAGTCGAAATACTCAAAATTTTCTCATAGAAACTACATCTATTGTTTC[G/A]
ACATAATATTTTCTTATAAATTGAAAACTATACAGTTTCAAGTAATTTTACTTTAGAATTTATGTGCTGCAAGGGTAATTAGAAGAAAACCATAACCAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.00% | 7.30% | 0.66% | 1.02% | NA |
| All Indica | 2759 | 84.70% | 12.50% | 1.12% | 1.74% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.80% | 4.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 70.20% | 23.00% | 2.41% | 4.38% | NA |
| Indica Intermediate | 786 | 84.20% | 13.90% | 0.89% | 1.02% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0131152445 | C -> T | LOC_Os01g54160.1 | upstream_gene_variant ; 1513.0bp to feature; MODIFIER | silent_mutation | Average:40.823; most accessible tissue: Callus, score: 65.729 | N | N | N | N |
| vg0131152445 | C -> T | LOC_Os01g54170.1 | downstream_gene_variant ; 4948.0bp to feature; MODIFIER | silent_mutation | Average:40.823; most accessible tissue: Callus, score: 65.729 | N | N | N | N |
| vg0131152445 | C -> T | LOC_Os01g54160-LOC_Os01g54170 | intergenic_region ; MODIFIER | silent_mutation | Average:40.823; most accessible tissue: Callus, score: 65.729 | N | N | N | N |
| vg0131152445 | C -> DEL | N | N | silent_mutation | Average:40.823; most accessible tissue: Callus, score: 65.729 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0131152445 | NA | 9.44E-07 | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131152445 | NA | 6.82E-07 | mr1237 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131152445 | 1.44E-06 | NA | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131152445 | 2.45E-06 | 2.45E-06 | mr1275 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131152445 | 6.35E-06 | NA | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131152445 | 1.65E-06 | 1.65E-06 | mr1345 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131152445 | 4.68E-06 | 4.79E-07 | mr1427 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131152445 | NA | 1.01E-07 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131152445 | 8.21E-06 | 6.70E-08 | mr1677 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131152445 | NA | 3.30E-06 | mr1678 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131152445 | NA | 5.70E-06 | mr1678 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131152445 | 3.03E-06 | 3.03E-06 | mr1777 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |