\
| Variant ID: vg0131033386 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr01 | Position: 31033386 |
| Reference Allele: A | Alternative Allele: T,AT,ATTT,ATT,ATTTT |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, A: 0.24, others allele: 0.00, population size: 45. )
CTCGGCTGCGTTCGAGTGCAGGAGAAAGAGAGAAAGATATTTTTGTTTTCCGCGCGCACACTTCCCGAACTACTAAACGGTGTGTTTTTTTAAAAAAAAA[A/T,AT,ATTT,ATT,ATTTT]
TCTATAGGAAAGTTGCTTTAAAAAATCATATTAATCTATTTTTGAAGTTTAAAATAATTAATACTCAATTAATCATGTGCTAATGGCTCACCTCGTTTTA
TAAAACGAGGTGAGCCATTAGCACATGATTAATTGAGTATTAATTATTTTAAACTTCAAAAATAGATTAATATGATTTTTTAAAGCAACTTTCCTATAGA[T/A,AT,AAAT,AAT,AAAAT]
TTTTTTTTTAAAAAAACACACCGTTTAGTAGTTCGGGAAGTGTGCGCGCGGAAAACAAAAATATCTTTCTCTCTTTCTCCTGCACTCGAACGCAGCCGAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.50% | 42.80% | 0.72% | 0.00% | AT: 3.13%; ATT: 1.71%; ATTT: 0.15% |
| All Indica | 2759 | 60.80% | 35.40% | 0.29% | 0.00% | ATT: 2.75%; AT: 0.43%; ATTT: 0.25% |
| All Japonica | 1512 | 46.60% | 47.80% | 1.32% | 0.00% | AT: 4.03%; ATT: 0.26% |
| Aus | 269 | 2.20% | 95.90% | 0.00% | 0.00% | AT: 1.86% |
| Indica I | 595 | 51.30% | 47.60% | 0.50% | 0.00% | ATTT: 0.34%; AT: 0.34% |
| Indica II | 465 | 96.60% | 1.70% | 0.00% | 0.00% | ATT: 1.29%; ATTT: 0.22%; AT: 0.22% |
| Indica III | 913 | 49.20% | 44.00% | 0.22% | 0.00% | ATT: 6.13%; ATTT: 0.22%; AT: 0.22% |
| Indica Intermediate | 786 | 60.40% | 36.30% | 0.38% | 0.00% | ATT: 1.78%; AT: 0.89%; ATTT: 0.25% |
| Temperate Japonica | 767 | 64.70% | 32.90% | 1.96% | 0.00% | AT: 0.52% |
| Tropical Japonica | 504 | 9.10% | 79.80% | 0.20% | 0.00% | AT: 10.32%; ATT: 0.60% |
| Japonica Intermediate | 241 | 67.20% | 28.60% | 1.66% | 0.00% | AT: 2.07%; ATT: 0.41% |
| VI/Aromatic | 96 | 5.20% | 37.50% | 1.04% | 0.00% | AT: 55.21%; ATT: 1.04% |
| Intermediate | 90 | 46.70% | 28.90% | 5.56% | 0.00% | AT: 18.89% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0131033386 | A -> AT | LOC_Os01g53960.1 | upstream_gene_variant ; 4418.0bp to feature; MODIFIER | silent_mutation | Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0131033386 | A -> AT | LOC_Os01g53970.1 | upstream_gene_variant ; 1455.0bp to feature; MODIFIER | silent_mutation | Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0131033386 | A -> AT | LOC_Os01g53970-LOC_Os01g53980 | intergenic_region ; MODIFIER | silent_mutation | Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0131033386 | A -> T | LOC_Os01g53960.1 | upstream_gene_variant ; 4417.0bp to feature; MODIFIER | silent_mutation | Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0131033386 | A -> T | LOC_Os01g53970.1 | upstream_gene_variant ; 1454.0bp to feature; MODIFIER | silent_mutation | Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0131033386 | A -> T | LOC_Os01g53970-LOC_Os01g53980 | intergenic_region ; MODIFIER | silent_mutation | Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0131033386 | A -> ATT | LOC_Os01g53960.1 | upstream_gene_variant ; 4418.0bp to feature; MODIFIER | silent_mutation | Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0131033386 | A -> ATT | LOC_Os01g53970.1 | upstream_gene_variant ; 1455.0bp to feature; MODIFIER | silent_mutation | Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0131033386 | A -> ATT | LOC_Os01g53970-LOC_Os01g53980 | intergenic_region ; MODIFIER | silent_mutation | Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0131033386 | A -> ATTTT | LOC_Os01g53960.1 | upstream_gene_variant ; 4418.0bp to feature; MODIFIER | N | Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0131033386 | A -> ATTTT | LOC_Os01g53970.1 | upstream_gene_variant ; 1455.0bp to feature; MODIFIER | N | Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0131033386 | A -> ATTTT | LOC_Os01g53970-LOC_Os01g53980 | intergenic_region ; MODIFIER | N | Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0131033386 | A -> ATTT | LOC_Os01g53960.1 | upstream_gene_variant ; 4418.0bp to feature; MODIFIER | silent_mutation | Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0131033386 | A -> ATTT | LOC_Os01g53970.1 | upstream_gene_variant ; 1455.0bp to feature; MODIFIER | silent_mutation | Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0131033386 | A -> ATTT | LOC_Os01g53970-LOC_Os01g53980 | intergenic_region ; MODIFIER | silent_mutation | Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0131033386 | NA | 4.27E-08 | mr1070 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131033386 | NA | 2.34E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131033386 | NA | 6.92E-08 | mr1092 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131033386 | NA | 1.38E-08 | mr1097 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131033386 | 4.61E-07 | 4.61E-07 | mr1128 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131033386 | NA | 9.64E-07 | mr1148 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131033386 | NA | 3.03E-07 | mr1154 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131033386 | 2.16E-09 | 2.16E-09 | mr1074_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131033386 | 1.80E-08 | NA | mr1092_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131033386 | 4.07E-10 | 4.12E-13 | mr1092_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131033386 | 3.65E-06 | 1.96E-12 | mr1097_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131033386 | 4.67E-08 | 2.71E-11 | mr1097_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131033386 | 1.42E-06 | NA | mr1128_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131033386 | 1.30E-08 | 7.48E-11 | mr1128_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131033386 | 4.55E-06 | 1.07E-07 | mr1148_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131033386 | 7.89E-07 | NA | mr1152_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131033386 | 6.69E-08 | 5.24E-11 | mr1152_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131033386 | 1.29E-08 | NA | mr1154_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131033386 | 7.48E-10 | 1.00E-13 | mr1154_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131033386 | 1.51E-06 | 1.11E-23 | mr1164_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131033386 | NA | 7.74E-08 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131033386 | NA | 5.61E-07 | mr1204_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131033386 | NA | 9.22E-06 | mr1896_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |