\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0131033386:

Variant ID: vg0131033386 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 31033386
Reference Allele: AAlternative Allele: T,AT,ATTT,ATT,ATTTT
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, A: 0.24, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


CTCGGCTGCGTTCGAGTGCAGGAGAAAGAGAGAAAGATATTTTTGTTTTCCGCGCGCACACTTCCCGAACTACTAAACGGTGTGTTTTTTTAAAAAAAAA[A/T,AT,ATTT,ATT,ATTTT]
TCTATAGGAAAGTTGCTTTAAAAAATCATATTAATCTATTTTTGAAGTTTAAAATAATTAATACTCAATTAATCATGTGCTAATGGCTCACCTCGTTTTA

Reverse complement sequence

TAAAACGAGGTGAGCCATTAGCACATGATTAATTGAGTATTAATTATTTTAAACTTCAAAAATAGATTAATATGATTTTTTAAAGCAACTTTCCTATAGA[T/A,AT,AAAT,AAT,AAAAT]
TTTTTTTTTAAAAAAACACACCGTTTAGTAGTTCGGGAAGTGTGCGCGCGGAAAACAAAAATATCTTTCTCTCTTTCTCCTGCACTCGAACGCAGCCGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.50% 42.80% 0.72% 0.00% AT: 3.13%; ATT: 1.71%; ATTT: 0.15%
All Indica  2759 60.80% 35.40% 0.29% 0.00% ATT: 2.75%; AT: 0.43%; ATTT: 0.25%
All Japonica  1512 46.60% 47.80% 1.32% 0.00% AT: 4.03%; ATT: 0.26%
Aus  269 2.20% 95.90% 0.00% 0.00% AT: 1.86%
Indica I  595 51.30% 47.60% 0.50% 0.00% ATTT: 0.34%; AT: 0.34%
Indica II  465 96.60% 1.70% 0.00% 0.00% ATT: 1.29%; ATTT: 0.22%; AT: 0.22%
Indica III  913 49.20% 44.00% 0.22% 0.00% ATT: 6.13%; ATTT: 0.22%; AT: 0.22%
Indica Intermediate  786 60.40% 36.30% 0.38% 0.00% ATT: 1.78%; AT: 0.89%; ATTT: 0.25%
Temperate Japonica  767 64.70% 32.90% 1.96% 0.00% AT: 0.52%
Tropical Japonica  504 9.10% 79.80% 0.20% 0.00% AT: 10.32%; ATT: 0.60%
Japonica Intermediate  241 67.20% 28.60% 1.66% 0.00% AT: 2.07%; ATT: 0.41%
VI/Aromatic  96 5.20% 37.50% 1.04% 0.00% AT: 55.21%; ATT: 1.04%
Intermediate  90 46.70% 28.90% 5.56% 0.00% AT: 18.89%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0131033386 A -> AT LOC_Os01g53960.1 upstream_gene_variant ; 4418.0bp to feature; MODIFIER silent_mutation Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0131033386 A -> AT LOC_Os01g53970.1 upstream_gene_variant ; 1455.0bp to feature; MODIFIER silent_mutation Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0131033386 A -> AT LOC_Os01g53970-LOC_Os01g53980 intergenic_region ; MODIFIER silent_mutation Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0131033386 A -> T LOC_Os01g53960.1 upstream_gene_variant ; 4417.0bp to feature; MODIFIER silent_mutation Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0131033386 A -> T LOC_Os01g53970.1 upstream_gene_variant ; 1454.0bp to feature; MODIFIER silent_mutation Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0131033386 A -> T LOC_Os01g53970-LOC_Os01g53980 intergenic_region ; MODIFIER silent_mutation Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0131033386 A -> ATT LOC_Os01g53960.1 upstream_gene_variant ; 4418.0bp to feature; MODIFIER silent_mutation Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0131033386 A -> ATT LOC_Os01g53970.1 upstream_gene_variant ; 1455.0bp to feature; MODIFIER silent_mutation Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0131033386 A -> ATT LOC_Os01g53970-LOC_Os01g53980 intergenic_region ; MODIFIER silent_mutation Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0131033386 A -> ATTTT LOC_Os01g53960.1 upstream_gene_variant ; 4418.0bp to feature; MODIFIER N Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0131033386 A -> ATTTT LOC_Os01g53970.1 upstream_gene_variant ; 1455.0bp to feature; MODIFIER N Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0131033386 A -> ATTTT LOC_Os01g53970-LOC_Os01g53980 intergenic_region ; MODIFIER N Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0131033386 A -> ATTT LOC_Os01g53960.1 upstream_gene_variant ; 4418.0bp to feature; MODIFIER silent_mutation Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0131033386 A -> ATTT LOC_Os01g53970.1 upstream_gene_variant ; 1455.0bp to feature; MODIFIER silent_mutation Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0131033386 A -> ATTT LOC_Os01g53970-LOC_Os01g53980 intergenic_region ; MODIFIER silent_mutation Average:54.541; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0131033386 NA 4.27E-08 mr1070 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131033386 NA 2.34E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131033386 NA 6.92E-08 mr1092 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131033386 NA 1.38E-08 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131033386 4.61E-07 4.61E-07 mr1128 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131033386 NA 9.64E-07 mr1148 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131033386 NA 3.03E-07 mr1154 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131033386 2.16E-09 2.16E-09 mr1074_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131033386 1.80E-08 NA mr1092_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131033386 4.07E-10 4.12E-13 mr1092_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131033386 3.65E-06 1.96E-12 mr1097_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131033386 4.67E-08 2.71E-11 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131033386 1.42E-06 NA mr1128_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131033386 1.30E-08 7.48E-11 mr1128_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131033386 4.55E-06 1.07E-07 mr1148_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131033386 7.89E-07 NA mr1152_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131033386 6.69E-08 5.24E-11 mr1152_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131033386 1.29E-08 NA mr1154_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131033386 7.48E-10 1.00E-13 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131033386 1.51E-06 1.11E-23 mr1164_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131033386 NA 7.74E-08 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131033386 NA 5.61E-07 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131033386 NA 9.22E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251