\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130989284:

Variant ID: vg0130989284 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 30989284
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


CCGAACTGATTCTATTGATCGCTTACGCGTTAGCTTAGGAGGTAATAAAGGAAAAAAAAAAGAGAGAAAGAGGTTAAGGACCGAGATGAATTGATCTGCA[T/C]
GAGTCCCATTTTTTTTCGGCACATATAATGTCCAAATAACTCTTCAGGACTGTTTGGATAATAGGTTAAGAGGAATCGAATTAAGATAGGAATATAAGTG

Reverse complement sequence

CACTTATATTCCTATCTTAATTCGATTCCTCTTAACCTATTATCCAAACAGTCCTGAAGAGTTATTTGGACATTATATGTGCCGAAAAAAAATGGGACTC[A/G]
TGCAGATCAATTCATCTCGGTCCTTAACCTCTTTCTCTCTTTTTTTTTTCCTTTATTACCTCCTAAGCTAACGCGTAAGCGATCAATAGAATCAGTTCGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.00% 5.40% 0.55% 0.00% NA
All Indica  2759 89.80% 9.30% 0.94% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.60% 2.50% 0.84% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 82.00% 17.30% 0.66% 0.00% NA
Indica Intermediate  786 88.20% 9.90% 1.91% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130989284 T -> C LOC_Os01g53890.1 upstream_gene_variant ; 2493.0bp to feature; MODIFIER silent_mutation Average:63.752; most accessible tissue: Callus, score: 88.747 N N N N
vg0130989284 T -> C LOC_Os01g53900.1 upstream_gene_variant ; 3127.0bp to feature; MODIFIER silent_mutation Average:63.752; most accessible tissue: Callus, score: 88.747 N N N N
vg0130989284 T -> C LOC_Os01g53890-LOC_Os01g53900 intergenic_region ; MODIFIER silent_mutation Average:63.752; most accessible tissue: Callus, score: 88.747 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130989284 6.68E-06 4.26E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130989284 1.94E-06 1.44E-07 mr1973 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130989284 NA 4.59E-06 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130989284 6.27E-06 NA mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130989284 6.67E-08 2.64E-08 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251