\
| Variant ID: vg0130973353 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 30973353 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 277. )
AGAAAAAATAAGTATCATCTATTCCCTCCATCCTAAAATGTAACAACCTAATTAATACACACATCATAATACTAGAAAATGTGTCTAACTAGTACTAGGG[A/C]
CTTGTTTAGATTCAAACTTTTTTCTTCAAACTTCCAACTTTTCCGTCACATCAAATGTTTGGACACATGCATGGAGCATTAAATGTGGACGAAAAAAACC
GGTTTTTTTCGTCCACATTTAATGCTCCATGCATGTGTCCAAACATTTGATGTGACGGAAAAGTTGGAAGTTTGAAGAAAAAAGTTTGAATCTAAACAAG[T/G]
CCCTAGTACTAGTTAGACACATTTTCTAGTATTATGATGTGTGTATTAATTAGGTTGTTACATTTTAGGATGGAGGGAATAGATGATACTTATTTTTTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.40% | 17.40% | 2.20% | 0.00% | NA |
| All Indica | 2759 | 98.50% | 1.50% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 47.40% | 46.00% | 6.61% | 0.00% | NA |
| Aus | 269 | 81.40% | 18.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.30% | 2.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 31.40% | 58.90% | 9.65% | 0.00% | NA |
| Tropical Japonica | 504 | 77.40% | 20.80% | 1.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 35.30% | 57.70% | 7.05% | 0.00% | NA |
| VI/Aromatic | 96 | 80.20% | 19.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 18.90% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0130973353 | A -> C | LOC_Os01g53880.1 | upstream_gene_variant ; 2412.0bp to feature; MODIFIER | silent_mutation | Average:37.219; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0130973353 | A -> C | LOC_Os01g53880.2 | upstream_gene_variant ; 2412.0bp to feature; MODIFIER | silent_mutation | Average:37.219; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0130973353 | A -> C | LOC_Os01g53880.3 | upstream_gene_variant ; 2412.0bp to feature; MODIFIER | silent_mutation | Average:37.219; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0130973353 | A -> C | LOC_Os01g53880.4 | upstream_gene_variant ; 2412.0bp to feature; MODIFIER | silent_mutation | Average:37.219; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0130973353 | A -> C | LOC_Os01g53880.5 | upstream_gene_variant ; 2412.0bp to feature; MODIFIER | silent_mutation | Average:37.219; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0130973353 | A -> C | LOC_Os01g53880.6 | upstream_gene_variant ; 2412.0bp to feature; MODIFIER | silent_mutation | Average:37.219; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0130973353 | A -> C | LOC_Os01g53880.7 | upstream_gene_variant ; 2412.0bp to feature; MODIFIER | silent_mutation | Average:37.219; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0130973353 | A -> C | LOC_Os01g53870.1 | downstream_gene_variant ; 3373.0bp to feature; MODIFIER | silent_mutation | Average:37.219; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0130973353 | A -> C | LOC_Os01g53870-LOC_Os01g53880 | intergenic_region ; MODIFIER | silent_mutation | Average:37.219; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0130973353 | NA | 5.92E-11 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0130973353 | NA | 2.32E-15 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0130973353 | NA | 4.25E-15 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0130973353 | NA | 2.80E-12 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0130973353 | 1.52E-07 | NA | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 1.13E-07 | 4.41E-10 | mr1070 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 6.74E-06 | NA | mr1089 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 1.78E-06 | NA | mr1092 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | NA | 8.42E-08 | mr1092 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 4.49E-07 | NA | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | NA | 2.22E-08 | mr1097 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 4.91E-07 | NA | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 2.03E-08 | 2.03E-08 | mr1128 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 5.64E-06 | NA | mr1148 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 6.32E-06 | 1.49E-07 | mr1148 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 6.73E-07 | NA | mr1154 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | NA | 4.81E-09 | mr1154 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | NA | 7.59E-09 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | NA | 8.89E-06 | mr1872 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | NA | 1.22E-07 | mr1896 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 1.50E-07 | NA | mr1074_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 1.82E-10 | 1.82E-10 | mr1074_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 3.86E-07 | NA | mr1089_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | NA | 1.46E-10 | mr1089_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 6.21E-10 | NA | mr1092_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 2.55E-08 | 7.97E-12 | mr1092_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 1.69E-07 | NA | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 1.94E-07 | 2.96E-12 | mr1097_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 1.56E-07 | NA | mr1128_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 3.12E-08 | 4.92E-10 | mr1128_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 7.05E-06 | NA | mr1129_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 5.62E-06 | 6.51E-10 | mr1129_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 3.73E-06 | NA | mr1148_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 7.06E-07 | 3.06E-09 | mr1148_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 1.02E-08 | NA | mr1152_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 6.33E-07 | 2.81E-10 | mr1152_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 2.83E-08 | NA | mr1154_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 1.17E-07 | 8.77E-12 | mr1154_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | NA | 7.97E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 7.13E-07 | 2.56E-08 | mr1204_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 8.77E-07 | 7.16E-10 | mr1204_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 3.21E-06 | 5.64E-10 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | NA | 1.34E-08 | mr1252_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | NA | 7.87E-07 | mr1671_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | NA | 6.12E-10 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | NA | 1.35E-09 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | NA | 9.49E-06 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | 7.80E-08 | 7.80E-08 | mr1889_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130973353 | NA | 1.21E-07 | mr1896_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |