Search for Variation information by Variation ID:
Detailed information for vg0130967803:
| Variant ID: vg0130967803 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 30967803 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 123. )
Flanking Sequence (100 bp) in Reference Genome:
TGACGAAGATGACTTGGAGGAGGAACGCGTGGAGGTGTTCGGCAACACTGCCTCGCCTCGGATCGATGGGTCGCAGCCGGAGACGAAGACGGAGCCGGAC[G/A]
ATGACGGTACCGGTGCTGGTGGCAACGGCGCGCCGTCCGGCTCAAGTGCTAGCAACAAACGGTCCAGATCTCAGGTATGGAACGACTTTGAAGAGCTCTA
Reverse complement sequence
TAGAGCTCTTCAAAGTCGTTCCATACCTGAGATCTGGACCGTTTGTTGCTAGCACTTGAGCCGGACGGCGCGCCGTTGCCACCAGCACCGGTACCGTCAT[C/T]
GTCCGGCTCCGTCTTCGTCTCCGGCTGCGACCCATCGATCCGAGGCGAGGCAGTGTTGCCGAACACCTCCACGCGTTCCTCCTCCAAGTCATCTTCGTCA
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.90% | 9.10% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 84.40% | 15.60% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 69.40% | 30.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 84.40% | 15.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0130967803 | G -> A | LOC_Os01g53870.1 | missense_variant ; p.Asp53Asn; MODERATE | nonsynonymous_codon ; D53N | Average:47.671; most accessible tissue: Minghui63 panicle, score: 62.157 | possibly damaging  |
1.641 |
TOLERATED | 0.33 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0130967803 | NA | 1.14E-07 | mr1237 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130967803 | 7.29E-06 | NA | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130967803 | NA | 4.36E-06 | mr1286 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130967803 | 2.44E-06 | 5.73E-07 | mr1392 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130967803 | NA | 9.03E-06 | mr1427 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130967803 | NA | 4.53E-07 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130967803 | NA | 3.26E-07 | mr1677 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130967803 | NA | 5.06E-06 | mr1678 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130967803 | NA | 8.58E-06 | mr1678 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130967803 | 4.04E-06 | 4.04E-06 | mr1777 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |