\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130916477:

Variant ID: vg0130916477 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 30916477
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


CACATGATGTCTTGGATATTGTGTAGAAACCATGTCTCATGCAAGACATGGTTTTCTTCTCTTTCCTCATTTATTCACTTGCCACATCATTTTTTGTCCT[A/G]
CGTGGCAACTTATTTAATGATATGAACACCATCCTAATCATTGGGTTGGGAATGCCCTCAGAACAACTAATCTTGCAAGATTTCAATATACGAATCAGTT

Reverse complement sequence

AACTGATTCGTATATTGAAATCTTGCAAGATTAGTTGTTCTGAGGGCATTCCCAACCCAATGATTAGGATGGTGTTCATATCATTAAATAAGTTGCCACG[T/C]
AGGACAAAAAATGATGTGGCAAGTGAATAAATGAGGAAAGAGAAGAAAACCATGTCTTGCATGAGACATGGTTTCTACACAATATCCAAGACATCATGTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.00% 9.00% 0.00% 0.00% NA
All Indica  2759 84.70% 15.30% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 69.40% 30.60% 0.00% 0.00% NA
Indica Intermediate  786 85.20% 14.80% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130916477 A -> G LOC_Os01g53790.1 upstream_gene_variant ; 1627.0bp to feature; MODIFIER silent_mutation Average:67.517; most accessible tissue: Callus, score: 90.525 N N N N
vg0130916477 A -> G LOC_Os01g53779.2 downstream_gene_variant ; 1.0bp to feature; MODIFIER silent_mutation Average:67.517; most accessible tissue: Callus, score: 90.525 N N N N
vg0130916477 A -> G LOC_Os01g53779-LOC_Os01g53790 intergenic_region ; MODIFIER silent_mutation Average:67.517; most accessible tissue: Callus, score: 90.525 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130916477 NA 8.07E-06 mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130916477 9.11E-06 NA mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130916477 9.54E-06 9.54E-06 mr1275 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130916477 5.11E-06 1.35E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130916477 NA 3.51E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130916477 NA 5.42E-07 mr1677 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130916477 NA 4.11E-07 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251