\
| Variant ID: vg0130916477 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 30916477 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 268. )
CACATGATGTCTTGGATATTGTGTAGAAACCATGTCTCATGCAAGACATGGTTTTCTTCTCTTTCCTCATTTATTCACTTGCCACATCATTTTTTGTCCT[A/G]
CGTGGCAACTTATTTAATGATATGAACACCATCCTAATCATTGGGTTGGGAATGCCCTCAGAACAACTAATCTTGCAAGATTTCAATATACGAATCAGTT
AACTGATTCGTATATTGAAATCTTGCAAGATTAGTTGTTCTGAGGGCATTCCCAACCCAATGATTAGGATGGTGTTCATATCATTAAATAAGTTGCCACG[T/C]
AGGACAAAAAATGATGTGGCAAGTGAATAAATGAGGAAAGAGAAGAAAACCATGTCTTGCATGAGACATGGTTTCTACACAATATCCAAGACATCATGTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.00% | 9.00% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 84.70% | 15.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 69.40% | 30.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 85.20% | 14.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0130916477 | A -> G | LOC_Os01g53790.1 | upstream_gene_variant ; 1627.0bp to feature; MODIFIER | silent_mutation | Average:67.517; most accessible tissue: Callus, score: 90.525 | N | N | N | N |
| vg0130916477 | A -> G | LOC_Os01g53779.2 | downstream_gene_variant ; 1.0bp to feature; MODIFIER | silent_mutation | Average:67.517; most accessible tissue: Callus, score: 90.525 | N | N | N | N |
| vg0130916477 | A -> G | LOC_Os01g53779-LOC_Os01g53790 | intergenic_region ; MODIFIER | silent_mutation | Average:67.517; most accessible tissue: Callus, score: 90.525 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0130916477 | NA | 8.07E-06 | mr1043 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130916477 | 9.11E-06 | NA | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130916477 | 9.54E-06 | 9.54E-06 | mr1275 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130916477 | 5.11E-06 | 1.35E-06 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130916477 | NA | 3.51E-06 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130916477 | NA | 5.42E-07 | mr1677 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130916477 | NA | 4.11E-07 | mr1677 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |