\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130905507:

Variant ID: vg0130905507 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 30905507
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.03, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GACTATCTCTAGGTTAGTAGATAGCTTTGCTCTCTCTCTCCATTTAATCTCTTCCATGTAAGAAAACATGTTGACATGGATCTCTTGTAGATAGCCTATA[A/G]
ATAACCATTGCGGGTGTCCTTACTGGTGCTCTAACAAAGACACATTATATGATAACAGCACTAACAAATATGTTCATGAATGCAACTTAGAACTGGCTGA

Reverse complement sequence

TCAGCCAGTTCTAAGTTGCATTCATGAACATATTTGTTAGTGCTGTTATCATATAATGTGTCTTTGTTAGAGCACCAGTAAGGACACCCGCAATGGTTAT[T/C]
TATAGGCTATCTACAAGAGATCCATGTCAACATGTTTTCTTACATGGAAGAGATTAAATGGAGAGAGAGAGCAAAGCTATCTACTAACCTAGAGATAGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 40.40% 0.76% 0.00% NA
All Indica  2759 86.60% 12.20% 1.20% 0.00% NA
All Japonica  1512 9.80% 90.20% 0.00% 0.00% NA
Aus  269 78.80% 20.40% 0.74% 0.00% NA
Indica I  595 57.10% 38.30% 4.54% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 87.40% 11.80% 0.76% 0.00% NA
Temperate Japonica  767 17.50% 82.50% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 26.70% 72.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130905507 A -> G LOC_Os01g53760.1 upstream_gene_variant ; 2449.0bp to feature; MODIFIER silent_mutation Average:68.159; most accessible tissue: Zhenshan97 panicle, score: 85.254 N N N N
vg0130905507 A -> G LOC_Os01g53779.2 upstream_gene_variant ; 3923.0bp to feature; MODIFIER silent_mutation Average:68.159; most accessible tissue: Zhenshan97 panicle, score: 85.254 N N N N
vg0130905507 A -> G LOC_Os01g53750.1 downstream_gene_variant ; 4887.0bp to feature; MODIFIER silent_mutation Average:68.159; most accessible tissue: Zhenshan97 panicle, score: 85.254 N N N N
vg0130905507 A -> G LOC_Os01g53770.1 downstream_gene_variant ; 78.0bp to feature; MODIFIER silent_mutation Average:68.159; most accessible tissue: Zhenshan97 panicle, score: 85.254 N N N N
vg0130905507 A -> G LOC_Os01g53760-LOC_Os01g53770 intergenic_region ; MODIFIER silent_mutation Average:68.159; most accessible tissue: Zhenshan97 panicle, score: 85.254 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0130905507 A G 0.0 0.0 0.0 0.03 0.03 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130905507 NA 5.37E-15 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 3.72E-06 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 4.87E-08 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 2.39E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 1.13E-07 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 4.21E-09 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 6.18E-09 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 6.90E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 4.34E-10 mr1565 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 1.10E-10 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 9.60E-22 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 1.99E-08 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 5.60E-06 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 1.55E-24 mr1062_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 9.33E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 1.63E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 6.95E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 4.49E-07 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 1.02E-06 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 2.86E-07 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 3.75E-09 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 1.02E-12 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 1.82E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 1.47E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 7.57E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 4.03E-06 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 7.05E-09 mr1758_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130905507 NA 2.37E-13 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251