\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130903912:

Variant ID: vg0130903912 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 30903912
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


CGATACACAATGTTTAGCAGTTTAAAAAAGTGCGAACAAAAACTATGGCAAAATCTACATTTTAATGAAAACTAAGGTACTCTCTCCATCCACAAAAGTT[A/G]
CACATATTACATATTACTTTTTGACATAAAGACCAAGAAAAAATTAAATCACCTTGGATGTTACAAAATCAAGAAGTGAATATAAGCATGCAACCAATAA

Reverse complement sequence

TTATTGGTTGCATGCTTATATTCACTTCTTGATTTTGTAACATCCAAGGTGATTTAATTTTTTCTTGGTCTTTATGTCAAAAAGTAATATGTAATATGTG[T/C]
AACTTTTGTGGATGGAGAGAGTACCTTAGTTTTCATTAAAATGTAGATTTTGCCATAGTTTTTGTTCGCACTTTTTTAAACTGCTAAACATTGTGTATCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.40% 25.50% 0.11% 0.00% NA
All Indica  2759 98.30% 1.70% 0.00% 0.00% NA
All Japonica  1512 35.00% 64.80% 0.20% 0.00% NA
Aus  269 81.00% 19.00% 0.00% 0.00% NA
Indica I  595 96.80% 3.20% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 96.90% 3.10% 0.00% 0.00% NA
Temperate Japonica  767 20.50% 79.30% 0.26% 0.00% NA
Tropical Japonica  504 68.50% 31.50% 0.00% 0.00% NA
Japonica Intermediate  241 11.20% 88.40% 0.41% 0.00% NA
VI/Aromatic  96 7.30% 91.70% 1.04% 0.00% NA
Intermediate  90 54.40% 44.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130903912 A -> G LOC_Os01g53760.1 upstream_gene_variant ; 854.0bp to feature; MODIFIER silent_mutation Average:58.735; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0130903912 A -> G LOC_Os01g53750.1 downstream_gene_variant ; 3292.0bp to feature; MODIFIER silent_mutation Average:58.735; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0130903912 A -> G LOC_Os01g53770.1 downstream_gene_variant ; 1673.0bp to feature; MODIFIER silent_mutation Average:58.735; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0130903912 A -> G LOC_Os01g53760-LOC_Os01g53770 intergenic_region ; MODIFIER silent_mutation Average:58.735; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130903912 NA 3.63E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130903912 NA 8.56E-07 mr1092_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130903912 NA 1.65E-08 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130903912 NA 4.18E-07 mr1152_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130903912 NA 3.25E-08 mr1154_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251