\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130845945:

Variant ID: vg0130845945 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 30845945
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


ACACTGCAGAATAATCTTTGAAGGAACTACTGCATAATTGCAAGCAGCCTAATTGTCTCAACCTACCAAGCACCACAAACTTTAAAGGAACAGAACAATA[T/A]
TTTTTATGCCATGATCATTTAGAACCACAGTTAGCCATAAACCAATCGAGAGCAGGATTGTTTAGAACATGTTTCTGATGGTCATGAATTTCAGAACATT

Reverse complement sequence

AATGTTCTGAAATTCATGACCATCAGAAACATGTTCTAAACAATCCTGCTCTCGATTGGTTTATGGCTAACTGTGGTTCTAAATGATCATGGCATAAAAA[A/T]
TATTGTTCTGTTCCTTTAAAGTTTGTGGTGCTTGGTAGGTTGAGACAATTAGGCTGCTTGCAATTATGCAGTAGTTCCTTCAAAGATTATTCTGCAGTGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.80% 27.40% 22.01% 12.80% NA
All Indica  2759 58.70% 2.20% 27.22% 11.82% NA
All Japonica  1512 1.30% 69.20% 11.57% 17.86% NA
Aus  269 46.50% 17.10% 36.43% 0.00% NA
Indica I  595 56.30% 2.90% 34.79% 6.05% NA
Indica II  465 66.00% 1.50% 25.59% 6.88% NA
Indica III  913 54.20% 0.70% 23.55% 21.58% NA
Indica Intermediate  786 61.50% 4.10% 26.72% 7.76% NA
Temperate Japonica  767 0.70% 77.40% 17.34% 4.56% NA
Tropical Japonica  504 2.60% 46.60% 7.14% 43.65% NA
Japonica Intermediate  241 0.80% 90.50% 2.49% 6.22% NA
VI/Aromatic  96 5.20% 91.70% 3.12% 0.00% NA
Intermediate  90 17.80% 57.80% 14.44% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130845945 T -> A LOC_Os01g53680.1 upstream_gene_variant ; 715.0bp to feature; MODIFIER silent_mutation Average:55.052; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0130845945 T -> A LOC_Os01g53690.1 upstream_gene_variant ; 972.0bp to feature; MODIFIER silent_mutation Average:55.052; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0130845945 T -> A LOC_Os01g53700.1 downstream_gene_variant ; 4644.0bp to feature; MODIFIER silent_mutation Average:55.052; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0130845945 T -> A LOC_Os01g53680-LOC_Os01g53690 intergenic_region ; MODIFIER silent_mutation Average:55.052; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0130845945 T -> DEL N N silent_mutation Average:55.052; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130845945 NA 4.11E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130845945 NA 3.89E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130845945 NA 2.20E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130845945 NA 4.30E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130845945 NA 3.30E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130845945 NA 2.13E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130845945 NA 1.04E-12 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130845945 2.57E-08 2.57E-08 mr1074_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130845945 7.49E-06 1.77E-08 mr1092_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130845945 4.75E-06 1.92E-09 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130845945 NA 1.42E-07 mr1128_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130845945 6.84E-06 8.95E-09 mr1152_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130845945 5.73E-06 3.71E-09 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130845945 NA 3.24E-07 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251