Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130828230:

Variant ID: vg0130828230 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 30828230
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


ATCGAAGTTTGGCCTCACGCCCTCATAACTTCAGTCATGTGAGTTTTGTCCAATCTTCATAAAAAAAACACAACGGAGCTCTACACATCGCTCTTCTTAT[C/A]
CAGTTAGCCATTTGTAATCCTAGGCACCGTAAGGTACATATGAGCTAAAAGCCTAAAAAGGAATTTTGAGTGCTGCCGTAATATTCACACATTTCACTAA

Reverse complement sequence

TTAGTGAAATGTGTGAATATTACGGCAGCACTCAAAATTCCTTTTTAGGCTTTTAGCTCATATGTACCTTACGGTGCCTAGGATTACAAATGGCTAACTG[G/T]
ATAAGAAGAGCGATGTGTAGAGCTCCGTTGTGTTTTTTTTATGAAGATTGGACAAAACTCACATGACTGAAGTTATGAGGGCGTGAGGCCAAACTTCGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.60% 7.30% 0.17% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 77.60% 21.80% 0.53% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 96.30% 2.70% 0.91% 0.00% NA
Tropical Japonica  504 41.50% 58.30% 0.20% 0.00% NA
Japonica Intermediate  241 93.80% 6.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130828230 C -> A LOC_Os01g53660.1 upstream_gene_variant ; 541.0bp to feature; MODIFIER silent_mutation Average:79.238; most accessible tissue: Callus, score: 95.335 N N N N
vg0130828230 C -> A LOC_Os01g53670.1 upstream_gene_variant ; 4566.0bp to feature; MODIFIER silent_mutation Average:79.238; most accessible tissue: Callus, score: 95.335 N N N N
vg0130828230 C -> A LOC_Os01g53670.2 upstream_gene_variant ; 4566.0bp to feature; MODIFIER silent_mutation Average:79.238; most accessible tissue: Callus, score: 95.335 N N N N
vg0130828230 C -> A LOC_Os01g53670.3 upstream_gene_variant ; 4566.0bp to feature; MODIFIER silent_mutation Average:79.238; most accessible tissue: Callus, score: 95.335 N N N N
vg0130828230 C -> A LOC_Os01g53670.4 upstream_gene_variant ; 4566.0bp to feature; MODIFIER silent_mutation Average:79.238; most accessible tissue: Callus, score: 95.335 N N N N
vg0130828230 C -> A LOC_Os01g53640.1 downstream_gene_variant ; 4983.0bp to feature; MODIFIER silent_mutation Average:79.238; most accessible tissue: Callus, score: 95.335 N N N N
vg0130828230 C -> A LOC_Os01g53650.1 downstream_gene_variant ; 2560.0bp to feature; MODIFIER silent_mutation Average:79.238; most accessible tissue: Callus, score: 95.335 N N N N
vg0130828230 C -> A LOC_Os01g53650-LOC_Os01g53660 intergenic_region ; MODIFIER silent_mutation Average:79.238; most accessible tissue: Callus, score: 95.335 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0130828230 C A -0.01 0.0 0.0 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130828230 7.26E-06 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130828230 NA 1.09E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130828230 1.89E-07 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130828230 NA 1.15E-09 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130828230 NA 2.50E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130828230 NA 9.23E-06 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130828230 2.26E-08 NA mr1107 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130828230 NA 1.19E-06 mr1107 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130828230 NA 1.38E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130828230 NA 2.76E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130828230 NA 6.03E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130828230 NA 1.10E-07 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251