\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130814504:

Variant ID: vg0130814504 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 30814504
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.65, A: 0.35, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TTTAAGTCATTCTAGTATTTTCTACATTAATATAGATGTTAATGAATCTATATAGATATATATGTCTAAATTTATTAATATTAATATGAATGTGGAAAAT[A/G]
TTAGAATGACTTACATTGTGAAACAGAGGGAGTAGCTAGAACATATTGTACATGTATCAAAAAATTGCTTGCAACTACACAGTGACACAGACATATATAT

Reverse complement sequence

ATATATATGTCTGTGTCACTGTGTAGTTGCAAGCAATTTTTTGATACATGTACAATATGTTCTAGCTACTCCCTCTGTTTCACAATGTAAGTCATTCTAA[T/C]
ATTTTCCACATTCATATTAATATTAATAAATTTAGACATATATATCTATATAGATTCATTAACATCTATATTAATGTAGAAAATACTAGAATGACTTAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.40% 35.20% 2.35% 0.00% NA
All Indica  2759 90.40% 5.70% 3.91% 0.00% NA
All Japonica  1512 10.70% 89.20% 0.13% 0.00% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 73.60% 15.10% 11.26% 0.00% NA
Indica II  465 95.70% 3.90% 0.43% 0.00% NA
Indica III  913 99.30% 0.30% 0.33% 0.00% NA
Indica Intermediate  786 89.70% 5.70% 4.58% 0.00% NA
Temperate Japonica  767 18.60% 81.10% 0.26% 0.00% NA
Tropical Japonica  504 1.60% 98.40% 0.00% 0.00% NA
Japonica Intermediate  241 4.60% 95.40% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 30.00% 68.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130814504 A -> G LOC_Os01g53640.1 upstream_gene_variant ; 4438.0bp to feature; MODIFIER silent_mutation Average:38.477; most accessible tissue: Callus, score: 83.937 N N N N
vg0130814504 A -> G LOC_Os01g53630-LOC_Os01g53640 intergenic_region ; MODIFIER silent_mutation Average:38.477; most accessible tissue: Callus, score: 83.937 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130814504 NA 1.98E-10 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0130814504 NA 7.57E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130814504 NA 1.63E-08 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130814504 NA 4.26E-09 mr1008 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130814504 NA 2.21E-09 mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130814504 NA 2.62E-06 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130814504 NA 1.69E-07 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130814504 NA 3.60E-17 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130814504 NA 7.25E-11 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130814504 NA 9.93E-10 mr1527 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130814504 NA 3.90E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130814504 NA 3.05E-14 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130814504 NA 1.75E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130814504 NA 6.79E-08 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130814504 NA 3.54E-08 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130814504 1.54E-07 3.30E-12 mr1008_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130814504 NA 9.64E-08 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130814504 NA 1.42E-19 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130814504 8.64E-06 NA mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130814504 NA 9.67E-06 mr1156_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130814504 NA 1.85E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130814504 NA 4.43E-14 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251