\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130761957:

Variant ID: vg0130761957 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 30761957
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


CAAAGGAACACAGGCGAGATCGCCCCCCTAGGGGATGCCAAAACAACGTCTTCAAGAAGAGAAGCGACAAACCGCCGCCGCCGTCCGTCGGAGCTCAAAG[A/G]
AGCCAAGACTGGGCTTTCGCCCGGCAACCACCCTTGAGGGGTGAGACAGCACGACAACGCCCTCAAGAGGGGGAATGAACCATCGTTGTCGGTTCGGCCG

Reverse complement sequence

CGGCCGAACCGACAACGATGGTTCATTCCCCCTCTTGAGGGCGTTGTCGTGCTGTCTCACCCCTCAAGGGTGGTTGCCGGGCGAAAGCCCAGTCTTGGCT[T/C]
CTTTGAGCTCCGACGGACGGCGGCGGCGGTTTGTCGCTTCTCTTCTTGAAGACGTTGTTTTGGCATCCCCTAGGGGGGCGATCTCGCCTGTGTTCCTTTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.90% 23.50% 0.80% 40.75% NA
All Indica  2759 3.10% 27.10% 1.30% 68.43% NA
All Japonica  1512 92.80% 6.50% 0.13% 0.53% NA
Aus  269 3.70% 92.20% 0.00% 4.09% NA
Indica I  595 4.70% 41.80% 1.34% 52.10% NA
Indica II  465 2.40% 1.50% 1.94% 94.19% NA
Indica III  913 1.10% 31.40% 1.10% 66.37% NA
Indica Intermediate  786 4.70% 26.20% 1.15% 67.94% NA
Temperate Japonica  767 95.20% 4.40% 0.00% 0.39% NA
Tropical Japonica  504 97.00% 2.20% 0.00% 0.79% NA
Japonica Intermediate  241 76.30% 22.40% 0.83% 0.41% NA
VI/Aromatic  96 91.70% 5.20% 0.00% 3.12% NA
Intermediate  90 71.10% 11.10% 0.00% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130761957 A -> G LOC_Os01g53570.1 upstream_gene_variant ; 2132.0bp to feature; MODIFIER silent_mutation Average:50.839; most accessible tissue: Zhenshan97 flower, score: 97.088 N N N N
vg0130761957 A -> G LOC_Os01g53560.1 downstream_gene_variant ; 738.0bp to feature; MODIFIER silent_mutation Average:50.839; most accessible tissue: Zhenshan97 flower, score: 97.088 N N N N
vg0130761957 A -> G LOC_Os01g53560-LOC_Os01g53570 intergenic_region ; MODIFIER silent_mutation Average:50.839; most accessible tissue: Zhenshan97 flower, score: 97.088 N N N N
vg0130761957 A -> DEL N N silent_mutation Average:50.839; most accessible tissue: Zhenshan97 flower, score: 97.088 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0130761957 A G 0.01 0.01 0.0 0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130761957 NA 8.37E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130761957 4.88E-07 2.31E-113 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130761957 4.36E-07 3.18E-112 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130761957 NA 9.25E-76 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130761957 NA 1.28E-10 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130761957 NA 3.88E-14 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130761957 NA 4.72E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130761957 NA 5.67E-36 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130761957 NA 7.87E-13 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130761957 2.99E-06 3.67E-23 mr1580 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130761957 NA 6.60E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130761957 NA 1.32E-06 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130761957 NA 8.80E-18 mr1825 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130761957 NA 3.54E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130761957 NA 6.64E-13 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251