\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130736753:

Variant ID: vg0130736753 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 30736753
Reference Allele: CAlternative Allele: T,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TGGCTAGGAGGACATCCTCCCTTTTAAGGAGGTCCCTCTCTCCTAGAATAAGTAAGGTGATACTAAACTCCATATGCATGTCATCCCATGAGGTGAGCTT[C/T,A]
TGTGATTTTTCAAAGAATTAAGGCCTTACCCCATTTATTAATTCCAACACGACCAACCTACGTCTATGAATTCCATACACAAATTTAACATCGGGACGTG

Reverse complement sequence

CACGTCCCGATGTTAAATTTGTGTATGGAATTCATAGACGTAGGTTGGTCGTGTTGGAATTAATAAATGGGGTAAGGCCTTAATTCTTTGAAAAATCACA[G/A,T]
AAGCTCACCTCATGGGATGACATGCATATGGAGTTTAGTATCACCTTACTTATTCTAGGAGAGAGGGACCTCCTTAAAAGGGAGGATGTCCTCCTAGCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.60% 33.60% 0.63% 16.44% A: 0.70%
All Indica  2759 78.20% 2.10% 0.43% 19.28% NA
All Japonica  1512 6.50% 90.50% 0.66% 0.13% A: 2.18%
Aus  269 5.60% 5.20% 2.60% 86.62% NA
Indica I  595 59.00% 3.40% 0.50% 37.14% NA
Indica II  465 98.30% 0.90% 0.00% 0.86% NA
Indica III  913 80.80% 0.70% 0.33% 18.18% NA
Indica Intermediate  786 77.90% 3.40% 0.76% 17.94% NA
Temperate Japonica  767 4.80% 95.00% 0.13% 0.00% NA
Tropical Japonica  504 2.20% 89.30% 1.59% 0.40% A: 6.55%
Japonica Intermediate  241 20.70% 78.80% 0.41% 0.00% NA
VI/Aromatic  96 4.20% 91.70% 0.00% 4.17% NA
Intermediate  90 23.30% 68.90% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130736753 C -> T LOC_Os01g53520.1 upstream_gene_variant ; 1944.0bp to feature; MODIFIER silent_mutation Average:96.742; most accessible tissue: Zhenshan97 flower, score: 98.187 N N N N
vg0130736753 C -> T LOC_Os01g53520.2 upstream_gene_variant ; 1944.0bp to feature; MODIFIER silent_mutation Average:96.742; most accessible tissue: Zhenshan97 flower, score: 98.187 N N N N
vg0130736753 C -> T LOC_Os01g53500-LOC_Os01g53520 intergenic_region ; MODIFIER silent_mutation Average:96.742; most accessible tissue: Zhenshan97 flower, score: 98.187 N N N N
vg0130736753 C -> A LOC_Os01g53520.1 upstream_gene_variant ; 1944.0bp to feature; MODIFIER silent_mutation Average:96.742; most accessible tissue: Zhenshan97 flower, score: 98.187 N N N N
vg0130736753 C -> A LOC_Os01g53520.2 upstream_gene_variant ; 1944.0bp to feature; MODIFIER silent_mutation Average:96.742; most accessible tissue: Zhenshan97 flower, score: 98.187 N N N N
vg0130736753 C -> A LOC_Os01g53500-LOC_Os01g53520 intergenic_region ; MODIFIER silent_mutation Average:96.742; most accessible tissue: Zhenshan97 flower, score: 98.187 N N N N
vg0130736753 C -> DEL N N silent_mutation Average:96.742; most accessible tissue: Zhenshan97 flower, score: 98.187 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0130736753 C A -0.08 -0.1 -0.12 -0.02 -0.08 -0.07
vg0130736753 C T -0.08 -0.09 -0.1 -0.04 -0.07 -0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130736753 NA 1.14E-107 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130736753 NA 2.75E-106 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130736753 NA 6.29E-70 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130736753 NA 2.60E-11 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130736753 NA 7.83E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130736753 NA 4.36E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130736753 NA 2.85E-35 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130736753 NA 2.01E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130736753 NA 2.39E-21 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130736753 NA 2.83E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130736753 NA 5.45E-14 mr1128_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130736753 NA 1.23E-12 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130736753 NA 1.80E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130736753 4.88E-06 NA mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251