Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0130732205:

Variant ID: vg0130732205 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 30732205
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


TCGTCTGTAAACCGTGAGACGAATTTATTAAGTCTAATTAATCTATCATTAGCATATGTGAATTACTGTAGCGCTTATGACTAATCATGGACTAATTAGA[T/C]
TTAAAAGATTCGTCTTGCGATTTCTATACAAACTGTGCAATTAGTTTTTTATTTTATCTATATTTAATGCTCTATATATATATTCAAAGATTATATGTGA

Reverse complement sequence

TCACATATAATCTTTGAATATATATATAGAGCATTAAATATAGATAAAATAAAAAACTAATTGCACAGTTTGTATAGAAATCGCAAGACGAATCTTTTAA[A/G]
TCTAATTAGTCCATGATTAGTCATAAGCGCTACAGTAATTCACATATGCTAATGATAGATTAATTAGACTTAATAAATTCGTCTCACGGTTTACAGACGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.80% 34.40% 0.49% 5.29% NA
All Indica  2759 92.80% 1.90% 0.58% 4.68% NA
All Japonica  1512 6.70% 93.30% 0.00% 0.00% NA
Aus  269 50.60% 3.70% 2.60% 43.12% NA
Indica I  595 96.00% 3.20% 0.00% 0.84% NA
Indica II  465 98.70% 0.90% 0.00% 0.43% NA
Indica III  913 88.90% 0.50% 1.20% 9.31% NA
Indica Intermediate  786 91.50% 3.20% 0.64% 4.71% NA
Temperate Japonica  767 4.80% 95.20% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 97.40% 0.00% 0.00% NA
Japonica Intermediate  241 21.20% 78.80% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 91.70% 0.00% 1.04% NA
Intermediate  90 25.60% 70.00% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130732205 T -> DEL N N silent_mutation Average:85.754; most accessible tissue: Minghui63 flower, score: 94.622 N N N N
vg0130732205 T -> C LOC_Os01g53500.1 upstream_gene_variant ; 967.0bp to feature; MODIFIER silent_mutation Average:85.754; most accessible tissue: Minghui63 flower, score: 94.622 N N N N
vg0130732205 T -> C LOC_Os01g53500-LOC_Os01g53520 intergenic_region ; MODIFIER silent_mutation Average:85.754; most accessible tissue: Minghui63 flower, score: 94.622 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0130732205 T C 0.01 0.01 0.0 0.02 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130732205 NA 3.17E-21 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130732205 NA 4.54E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130732205 1.21E-08 2.27E-118 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130732205 7.10E-09 3.67E-117 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130732205 1.10E-06 4.49E-78 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130732205 3.11E-06 8.96E-78 mr1015 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130732205 NA 3.93E-11 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130732205 NA 2.44E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130732205 NA 2.67E-14 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130732205 NA 4.67E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130732205 NA 5.80E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130732205 NA 2.12E-12 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130732205 NA 2.73E-21 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130732205 NA 1.23E-81 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130732205 NA 2.76E-58 mr1695 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130732205 NA 7.15E-21 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130732205 NA 1.19E-06 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130732205 NA 3.47E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130732205 NA 3.90E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130732205 NA 4.13E-12 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251