\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130722455:

Variant ID: vg0130722455 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 30722455
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


CCTCAAAAGAACGCGGTTGCAGCGATCACCCTCCTCGACACCCTCCTCAAGGAAGACGCACTCAATCAAGCCAATCACGTCGTCAACATCTTGAACCAGA[T/C]
CAAGACCATGATCACCGCCTCGGTCCCGGTTAACTCTGCAAGCGTCCGCACGCCGACTGGCAGCCGAGTTCCCCCTCTTCGATCTCAAGACTATCACCAA

Reverse complement sequence

TTGGTGATAGTCTTGAGATCGAAGAGGGGGAACTCGGCTGCCAGTCGGCGTGCGGACGCTTGCAGAGTTAACCGGGACCGAGGCGGTGATCATGGTCTTG[A/G]
TCTGGTTCAAGATGTTGACGACGTGATTGGCTTGATTGAGTGCGTCTTCCTTGAGGAGGGTGTCGAGGAGGGTGATCGCTGCAACCGCGTTCTTTTGAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.40% 34.30% 0.19% 0.06% NA
All Indica  2759 97.80% 1.80% 0.25% 0.11% NA
All Japonica  1512 6.70% 93.30% 0.00% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 96.50% 3.20% 0.00% 0.34% NA
Indica II  465 98.90% 0.90% 0.22% 0.00% NA
Indica III  913 99.50% 0.30% 0.22% 0.00% NA
Indica Intermediate  786 96.20% 3.20% 0.51% 0.13% NA
Temperate Japonica  767 4.80% 95.20% 0.00% 0.00% NA
Tropical Japonica  504 2.80% 97.20% 0.00% 0.00% NA
Japonica Intermediate  241 21.20% 78.80% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 28.90% 68.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130722455 T -> DEL LOC_Os01g53480.1 N frameshift_variant Average:50.753; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0130722455 T -> C LOC_Os01g53480.1 missense_variant ; p.Ile528Thr; MODERATE nonsynonymous_codon ; I528T Average:50.753; most accessible tissue: Zhenshan97 panicle, score: 71.253 benign -0.391 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130722455 NA 4.49E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130722455 2.23E-06 2.24E-114 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130722455 1.00E-06 2.33E-113 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130722455 NA 5.20E-76 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130722455 NA 2.73E-11 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130722455 NA 1.33E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130722455 NA 7.69E-14 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130722455 NA 3.92E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130722455 NA 6.08E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130722455 NA 2.34E-12 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130722455 4.25E-06 6.38E-22 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130722455 NA 8.65E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130722455 NA 2.24E-22 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130722455 NA 2.37E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130722455 NA 2.10E-14 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130722455 NA 5.70E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130722455 NA 2.02E-12 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130722455 NA 2.27E-13 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130722455 1.38E-06 NA mr1580_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130722455 4.19E-07 NA mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251