\
| Variant ID: vg0130700573 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 30700573 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAAATGAAGAAATTCGTAAATATTCATTTAAAGAGCATATAAACTTCAAATGGCCATAACTTGGCCATTTGAACTCGGAATTGGACCGTTCAAGTCTCTA[A/T]
TTTTTCCTTAAGAAGTCGAGAACTCATTTTTGTGCTTTGTTCCTGCTTGTTATATGGAGTTTATTAGAGTAAAAGCTTTTTTCCTTTCCGTTGGTCGTGT
ACACGACCAACGGAAAGGAAAAAAGCTTTTACTCTAATAAACTCCATATAACAAGCAGGAACAAAGCACAAAAATGAGTTCTCGACTTCTTAAGGAAAAA[T/A]
TAGAGACTTGAACGGTCCAATTCCGAGTTCAAATGGCCAAGTTATGGCCATTTGAAGTTTATATGCTCTTTAAATGAATATTTACGAATTTCTTCATTTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.80% | 5.00% | 19.23% | 32.95% | NA |
| All Indica | 2759 | 20.60% | 0.10% | 29.79% | 49.55% | NA |
| All Japonica | 1512 | 77.60% | 15.20% | 1.92% | 5.22% | NA |
| Aus | 269 | 48.30% | 0.00% | 17.47% | 34.20% | NA |
| Indica I | 595 | 15.80% | 0.00% | 15.46% | 68.74% | NA |
| Indica II | 465 | 13.50% | 0.00% | 30.75% | 55.70% | NA |
| Indica III | 913 | 25.00% | 0.20% | 41.95% | 32.86% | NA |
| Indica Intermediate | 786 | 23.30% | 0.00% | 25.95% | 50.76% | NA |
| Temperate Japonica | 767 | 94.40% | 0.10% | 1.30% | 4.17% | NA |
| Tropical Japonica | 504 | 51.20% | 44.20% | 2.78% | 1.79% | NA |
| Japonica Intermediate | 241 | 79.70% | 2.50% | 2.07% | 15.77% | NA |
| VI/Aromatic | 96 | 92.70% | 0.00% | 1.04% | 6.25% | NA |
| Intermediate | 90 | 68.90% | 5.60% | 11.11% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0130700573 | A -> T | LOC_Os01g53430.1 | upstream_gene_variant ; 3863.0bp to feature; MODIFIER | silent_mutation | Average:22.912; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg0130700573 | A -> T | LOC_Os01g53430-LOC_Os01g53440 | intergenic_region ; MODIFIER | silent_mutation | Average:22.912; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| vg0130700573 | A -> DEL | N | N | silent_mutation | Average:22.912; most accessible tissue: Zhenshan97 panicle, score: 54.901 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0130700573 | 1.72E-06 | NA | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130700573 | 6.72E-06 | NA | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130700573 | 4.93E-10 | NA | mr1301_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130700573 | 2.68E-08 | NA | mr1410_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130700573 | NA | 8.19E-08 | mr1526_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |