Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130669509:

Variant ID: vg0130669509 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 30669509
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:

AATAAAAAAGATCCCAAAATTAATAAAAAAAATAAAAAGAAGGGTTCAACTAGAAATACAATTTAGAAAATGACTAAAATTCGAAATAAAAAAAAGAACG[A/G]
CAATGCTAGGGGACGGGATACCGTCCCCCAACGGGATAGCTCCTCTCCACACGCGATTCTTATCCATACACTCACTTGCCGCCGTCGCCGTCCCCCCTTC

Reverse complement sequence

GAAGGGGGGACGGCGACGGCGGCAAGTGAGTGTATGGATAAGAATCGCGTGTGGAGAGGAGCTATCCCGTTGGGGGACGGTATCCCGTCCCCTAGCATTG[T/C]
CGTTCTTTTTTTTATTTCGAATTTTAGTCATTTTCTAAATTGTATTTCTAGTTGAACCCTTCTTTTTATTTTTTTTATTAATTTTGGGATCTTTTTTATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.60%	34.40%	0.02%	1.93%	NA
All Indica	2759	97.90%	2.00%	0.04%	0.04%	NA
All Japonica	1512	0.80%	93.30%	0.00%	5.89%	NA
Aus	269	95.20%	4.50%	0.00%	0.37%	NA
Indica I	595	96.30%	3.40%	0.17%	0.17%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	96.60%	3.40%	0.00%	0.00%	NA
Temperate Japonica	767	0.30%	95.30%	0.00%	4.43%	NA
Tropical Japonica	504	1.20%	97.20%	0.00%	1.59%	NA
Japonica Intermediate	241	1.70%	78.80%	0.00%	19.50%	NA
VI/Aromatic	96	8.30%	91.70%	0.00%	0.00%	NA
Intermediate	90	33.30%	66.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0130669509	A -> G	LOC_Os01g53380.1	upstream_gene_variant ; 2023.0bp to feature; MODIFIER	silent_mutation	Average:55.494; most accessible tissue: Minghui63 young leaf, score: 67.374	N	N	N	N
vg0130669509	A -> G	LOC_Os01g53370.1	downstream_gene_variant ; 878.0bp to feature; MODIFIER	silent_mutation	Average:55.494; most accessible tissue: Minghui63 young leaf, score: 67.374	N	N	N	N
vg0130669509	A -> G	LOC_Os01g53370-LOC_Os01g53380	intergenic_region ; MODIFIER	silent_mutation	Average:55.494; most accessible tissue: Minghui63 young leaf, score: 67.374	N	N	N	N
vg0130669509	A -> DEL	N	N	silent_mutation	Average:55.494; most accessible tissue: Minghui63 young leaf, score: 67.374	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0130669509	NA	6.64E-21	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130669509	NA	6.19E-09	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130669509	2.03E-06	3.29E-116	mr1008	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130669509	1.67E-06	1.19E-114	mr1009	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130669509	4.51E-06	2.84E-78	mr1014	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130669509	NA	1.55E-77	mr1015	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130669509	NA	9.46E-26	mr1024	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130669509	NA	5.22E-12	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130669509	NA	2.09E-11	mr1128	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130669509	NA	1.13E-13	mr1239	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130669509	NA	2.92E-06	mr1508	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130669509	NA	1.16E-12	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130669509	NA	8.17E-22	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130669509	NA	6.01E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130669509	NA	2.65E-21	mr1698	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130669509	NA	9.37E-07	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130669509	NA	9.46E-17	mr1825	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130669509	NA	5.02E-20	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130669509	NA	1.36E-25	mr1051_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130669509	NA	1.22E-12	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130669509	NA	1.06E-13	mr1553_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251