\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130662242:

Variant ID: vg0130662242 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 30662242
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


GACTATTCTTTCAATATGCATTATTTTCTATTTCGAATTTTAATTATTTCTAAGTTCTATTCCTATTAGAACTCTTCATTGTTATTGGGATTTTAAAAAT[T/C,A]
GAACATGATTATTCTTTGGTTTTCTTTCTATAGTTTATAGAAGTCTCGCTAGCCGTCGGTGCCCATATACTTTGCCAGCTTCGTCTTGTCCTCTTATAAT

Reverse complement sequence

ATTATAAGAGGACAAGACGAAGCTGGCAAAGTATATGGGCACCGACGGCTAGCGAGACTTCTATAAACTATAGAAAGAAAACCAAAGAATAATCATGTTC[A/G,T]
ATTTTTAAAATCCCAATAACAATGAAGAGTTCTAATAGGAATAGAACTTAGAAATAATTAAAATTCGAAATAGAAAATAATGCATATTGAAAGAATAGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.50% 13.70% 0.87% 1.90% A: 0.04%
All Indica  2759 98.60% 1.10% 0.29% 0.00% A: 0.07%
All Japonica  1512 52.40% 39.60% 2.05% 5.89% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 96.60% 3.00% 0.34% 0.00% NA
Indica II  465 98.90% 0.00% 0.65% 0.00% A: 0.43%
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.30% 0.38% 0.00% NA
Temperate Japonica  767 31.80% 60.20% 3.52% 4.43% NA
Tropical Japonica  504 91.50% 6.50% 0.40% 1.59% NA
Japonica Intermediate  241 36.50% 43.20% 0.83% 19.50% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 77.80% 20.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130662242 T -> A LOC_Os01g53360.1 upstream_gene_variant ; 4362.0bp to feature; MODIFIER silent_mutation Average:30.128; most accessible tissue: Callus, score: 71.208 N N N N
vg0130662242 T -> A LOC_Os01g53370.1 upstream_gene_variant ; 4397.0bp to feature; MODIFIER silent_mutation Average:30.128; most accessible tissue: Callus, score: 71.208 N N N N
vg0130662242 T -> A LOC_Os01g53360-LOC_Os01g53370 intergenic_region ; MODIFIER silent_mutation Average:30.128; most accessible tissue: Callus, score: 71.208 N N N N
vg0130662242 T -> DEL N N silent_mutation Average:30.128; most accessible tissue: Callus, score: 71.208 N N N N
vg0130662242 T -> C LOC_Os01g53360.1 upstream_gene_variant ; 4362.0bp to feature; MODIFIER silent_mutation Average:30.128; most accessible tissue: Callus, score: 71.208 N N N N
vg0130662242 T -> C LOC_Os01g53370.1 upstream_gene_variant ; 4397.0bp to feature; MODIFIER silent_mutation Average:30.128; most accessible tissue: Callus, score: 71.208 N N N N
vg0130662242 T -> C LOC_Os01g53360-LOC_Os01g53370 intergenic_region ; MODIFIER silent_mutation Average:30.128; most accessible tissue: Callus, score: 71.208 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130662242 NA 4.31E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0130662242 NA 4.17E-14 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0130662242 7.63E-09 NA mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 1.68E-07 4.21E-10 mr1070 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 1.32E-06 NA mr1074 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 1.14E-09 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 7.58E-06 1.56E-10 mr1082 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 8.08E-10 NA mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 4.27E-07 7.20E-10 mr1092 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 3.64E-12 NA mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 2.66E-08 8.91E-13 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 2.09E-09 NA mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 6.81E-10 6.81E-10 mr1128 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 3.64E-09 NA mr1148 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 5.35E-09 4.98E-10 mr1148 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 9.86E-09 NA mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 1.89E-06 1.54E-07 mr1152 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 3.91E-11 NA mr1154 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 3.48E-08 1.26E-11 mr1154 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 NA 2.08E-08 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 8.76E-07 3.91E-09 mr1896 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 NA 9.72E-06 mr1910 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 5.33E-12 NA mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 4.46E-13 4.46E-13 mr1074_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 4.13E-10 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 NA 3.34E-09 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 4.56E-07 NA mr1089_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 2.25E-16 NA mr1092_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 4.26E-14 7.03E-18 mr1092_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 3.38E-12 NA mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 4.78E-12 2.77E-17 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 1.26E-12 NA mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 3.99E-12 4.03E-13 mr1128_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 2.96E-07 NA mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 NA 2.11E-08 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 1.52E-07 NA mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 5.49E-08 4.44E-10 mr1148_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 3.26E-15 NA mr1152_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 1.02E-11 4.15E-15 mr1152_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 3.96E-14 NA mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 1.60E-12 1.37E-16 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 1.31E-09 4.89E-10 mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 3.58E-08 5.84E-11 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 1.50E-07 6.11E-12 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 7.05E-06 6.52E-09 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 1.72E-06 NA mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 1.39E-06 1.39E-06 mr1889_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130662242 NA 3.83E-07 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251