\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130466262:

Variant ID: vg0130466262 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 30466262
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTAAACGATCTAACGGTAAAGATGTATCTGATATTTCACCCGGTTAGCTTTGCAGTATAAATTCGAAAAGGGTATATTTGTCTTTTCATCTTTCTGCGT[G/A]
GGGGTATTTTTGTATTTTCGCGTTTTGTTTCTTGGTCAGATCCCGACCTAGAGAAATCCAGTCGGTTTGTCGTTCGAAAGAAACGGCGGCTTGAGAGAAA

Reverse complement sequence

TTTCTCTCAAGCCGCCGTTTCTTTCGAACGACAAACCGACTGGATTTCTCTAGGTCGGGATCTGACCAAGAAACAAAACGCGAAAATACAAAAATACCCC[C/T]
ACGCAGAAAGATGAAAAGACAAATATACCCTTTTCGAATTTATACTGCAAAGCTAACCGGGTGAAATATCAGATACATCTTTACCGTTAGATCGTTTAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.90% 1.10% 0.97% 0.00% NA
All Indica  2759 99.40% 0.00% 0.58% 0.00% NA
All Japonica  1512 94.60% 3.40% 1.98% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 98.20% 0.00% 1.75% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 89.60% 6.50% 3.91% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130466262 G -> A LOC_Os01g53000.1 downstream_gene_variant ; 1730.0bp to feature; MODIFIER silent_mutation Average:69.79; most accessible tissue: Minghui63 panicle, score: 88.281 N N N N
vg0130466262 G -> A LOC_Os01g53010.1 downstream_gene_variant ; 1558.0bp to feature; MODIFIER silent_mutation Average:69.79; most accessible tissue: Minghui63 panicle, score: 88.281 N N N N
vg0130466262 G -> A LOC_Os01g53000.2 downstream_gene_variant ; 2673.0bp to feature; MODIFIER silent_mutation Average:69.79; most accessible tissue: Minghui63 panicle, score: 88.281 N N N N
vg0130466262 G -> A LOC_Os01g53000-LOC_Os01g53010 intergenic_region ; MODIFIER silent_mutation Average:69.79; most accessible tissue: Minghui63 panicle, score: 88.281 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130466262 NA 9.53E-09 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130466262 NA 1.30E-08 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130466262 NA 8.80E-06 mr1379 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130466262 5.63E-09 5.63E-09 mr1409 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130466262 NA 1.35E-08 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130466262 NA 1.34E-07 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130466262 NA 6.54E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130466262 NA 1.11E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251