RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0130466262:

Variant ID: vg0130466262 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 30466262
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTAAACGATCTAACGGTAAAGATGTATCTGATATTTCACCCGGTTAGCTTTGCAGTATAAATTCGAAAAGGGTATATTTGTCTTTTCATCTTTCTGCGT[G/A]
GGGGTATTTTTGTATTTTCGCGTTTTGTTTCTTGGTCAGATCCCGACCTAGAGAAATCCAGTCGGTTTGTCGTTCGAAAGAAACGGCGGCTTGAGAGAAA

Reverse complement sequence

TTTCTCTCAAGCCGCCGTTTCTTTCGAACGACAAACCGACTGGATTTCTCTAGGTCGGGATCTGACCAAGAAACAAAACGCGAAAATACAAAAATACCCC[C/T]
ACGCAGAAAGATGAAAAGACAAATATACCCTTTTCGAATTTATACTGCAAAGCTAACCGGGTGAAATATCAGATACATCTTTACCGTTAGATCGTTTAAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.90%	1.10%	0.97%	0.00%	NA
All Indica	2759	99.40%	0.00%	0.58%	0.00%	NA
All Japonica	1512	94.60%	3.40%	1.98%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	98.20%	0.00%	1.75%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	89.60%	6.50%	3.91%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0130466262	G -> A	LOC_Os01g53000.1	downstream_gene_variant ; 1730.0bp to feature; MODIFIER	silent_mutation	Average:69.79; most accessible tissue: Minghui63 panicle, score: 88.281	N	N	N	N
vg0130466262	G -> A	LOC_Os01g53010.1	downstream_gene_variant ; 1558.0bp to feature; MODIFIER	silent_mutation	Average:69.79; most accessible tissue: Minghui63 panicle, score: 88.281	N	N	N	N
vg0130466262	G -> A	LOC_Os01g53000.2	downstream_gene_variant ; 2673.0bp to feature; MODIFIER	silent_mutation	Average:69.79; most accessible tissue: Minghui63 panicle, score: 88.281	N	N	N	N
vg0130466262	G -> A	LOC_Os01g53000-LOC_Os01g53010	intergenic_region ; MODIFIER	silent_mutation	Average:69.79; most accessible tissue: Minghui63 panicle, score: 88.281	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0130466262	NA	9.53E-09	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130466262	NA	1.30E-08	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130466262	NA	8.80E-06	mr1379	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130466262	5.63E-09	5.63E-09	mr1409	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130466262	NA	1.35E-08	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130466262	NA	1.34E-07	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130466262	NA	6.54E-06	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130466262	NA	1.11E-07	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 8 of 8 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0130466262:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact