\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130239724:

Variant ID: vg0130239724 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 30239724
Reference Allele: TAlternative Allele: C,TGTACTGTAGC
Primary Allele: TSecondary Allele: TGTACTGTAGC

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GCACACACACGCACAGCTCGCATGCTAGCTTGCTTGACCAAGTCTTCCAACCAAGTGCATGCACGTGCACTTTCCTCATTGGCTGCATGCTACAGTACCA[T/C,TGTACTGTAGC]
ATGTACTGTAGCACTGCTTGCTCCTTTCCTCTGTCGGCTTTCTTCGCGAATCCCGGCACTTGCACTTTTGCACTTGACCTTGCGAAGTCCGTTGCAAAGA

Reverse complement sequence

TCTTTGCAACGGACTTCGCAAGGTCAAGTGCAAAAGTGCAAGTGCCGGGATTCGCGAAGAAAGCCGACAGAGGAAAGGAGCAAGCAGTGCTACAGTACAT[A/G,GCTACAGTACA]
TGGTACTGTAGCATGCAGCCAATGAGGAAAGTGCACGTGCATGCACTTGGTTGGAAGACTTGGTCAAGCAAGCTAGCATGCGAGCTGTGCGTGTGTGTGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of TGTACTGTAGC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.50% 6.40% 1.42% 4.63% C: 0.06%
All Indica  2759 87.20% 10.30% 0.40% 2.03% C: 0.07%
All Japonica  1512 91.10% 0.00% 1.65% 7.21% NA
Aus  269 90.30% 7.40% 1.86% 0.37% NA
Indica I  595 62.20% 36.00% 0.67% 1.01% C: 0.17%
Indica II  465 95.30% 0.20% 0.00% 4.52% NA
Indica III  913 96.50% 0.90% 0.44% 2.19% NA
Indica Intermediate  786 90.70% 7.60% 0.38% 1.15% C: 0.13%
Temperate Japonica  767 99.30% 0.00% 0.13% 0.52% NA
Tropical Japonica  504 77.80% 0.00% 3.97% 18.25% NA
Japonica Intermediate  241 92.90% 0.00% 1.66% 5.39% NA
VI/Aromatic  96 31.20% 0.00% 25.00% 43.75% NA
Intermediate  90 83.30% 1.10% 2.22% 12.22% C: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130239724 T -> TGTACTGTAGC LOC_Os01g52610.1 upstream_gene_variant ; 2223.0bp to feature; MODIFIER silent_mutation Average:99.461; most accessible tissue: Zhenshan97 panicle, score: 99.831 N N N N
vg0130239724 T -> TGTACTGTAGC LOC_Os01g52594.1 downstream_gene_variant ; 2949.0bp to feature; MODIFIER silent_mutation Average:99.461; most accessible tissue: Zhenshan97 panicle, score: 99.831 N N N N
vg0130239724 T -> TGTACTGTAGC LOC_Os01g52594-LOC_Os01g52610 intergenic_region ; MODIFIER silent_mutation Average:99.461; most accessible tissue: Zhenshan97 panicle, score: 99.831 N N N N
vg0130239724 T -> DEL N N silent_mutation Average:99.461; most accessible tissue: Zhenshan97 panicle, score: 99.831 N N N N
vg0130239724 T -> C LOC_Os01g52610.1 upstream_gene_variant ; 2224.0bp to feature; MODIFIER silent_mutation Average:99.461; most accessible tissue: Zhenshan97 panicle, score: 99.831 N N N N
vg0130239724 T -> C LOC_Os01g52594.1 downstream_gene_variant ; 2948.0bp to feature; MODIFIER silent_mutation Average:99.461; most accessible tissue: Zhenshan97 panicle, score: 99.831 N N N N
vg0130239724 T -> C LOC_Os01g52594-LOC_Os01g52610 intergenic_region ; MODIFIER silent_mutation Average:99.461; most accessible tissue: Zhenshan97 panicle, score: 99.831 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0130239724 T C -0.21 -0.14 -0.09 -0.11 -0.11 -0.11
vg0130239724 T TGTAC* 1.56 1.76 1.33 1.02 1.0 1.17

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130239724 NA 2.26E-06 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 5.24E-07 6.34E-06 mr1873 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 NA 9.50E-06 mr1278_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 2.54E-06 2.54E-06 mr1286_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 7.03E-06 7.03E-06 mr1312_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 6.49E-06 6.49E-06 mr1369_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 NA 6.84E-06 mr1373_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 3.31E-06 3.31E-06 mr1453_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 NA 3.71E-06 mr1467_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 NA 3.05E-07 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 1.86E-06 1.86E-06 mr1665_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 NA 4.60E-07 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 1.59E-06 1.59E-06 mr1687_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 3.54E-07 3.54E-07 mr1738_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 NA 1.96E-09 mr1759_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 NA 4.67E-06 mr1766_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 NA 3.51E-07 mr1811_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 7.49E-06 7.48E-06 mr1812_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 5.71E-06 5.71E-06 mr1816_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 NA 3.63E-06 mr1823_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 8.03E-06 8.03E-06 mr1832_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 8.48E-07 8.48E-07 mr1833_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 NA 3.08E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 NA 9.99E-06 mr1856_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 2.89E-06 2.89E-06 mr1979_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 7.09E-07 7.09E-07 mr1983_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130239724 NA 1.13E-06 mr1985_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251