\
| Variant ID: vg0130154178 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 30154178 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCCTATACACCCCGCACGCTGCTTCTCCTTTTTATTCTCATTGAGATTTTAAAAATCGAATATGTTTATCAATTGGTTTTTTTTTTACTTTCTAGAAGCC[C/T]
CGGCAACCGTCTTGCTCGTCCCTCCTTTTAATCATCATTAGGATTCTATTTGGTGTTTTACTAATAATTTTTATATAACGTATCAACTGCCACCACTATT
AATAGTGGTGGCAGTTGATACGTTATATAAAAATTATTAGTAAAACACCAAATAGAATCCTAATGATGATTAAAAGGAGGGACGAGCAAGACGGTTGCCG[G/A]
GGCTTCTAGAAAGTAAAAAAAAAACCAATTGATAAACATATTCGATTTTTAAAATCTCAATGAGAATAAAAAGGAGAAGCAGCGTGCGGGGTGTATAGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.90% | 12.00% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 82.90% | 17.00% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 68.00% | 31.60% | 0.37% | 0.00% | NA |
| Indica I | 595 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 70.60% | 29.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 81.20% | 18.30% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0130154178 | C -> T | LOC_Os01g52480.1 | upstream_gene_variant ; 1487.0bp to feature; MODIFIER | silent_mutation | Average:26.798; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0130154178 | C -> T | LOC_Os01g52490.1 | downstream_gene_variant ; 3704.0bp to feature; MODIFIER | silent_mutation | Average:26.798; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0130154178 | C -> T | LOC_Os01g52470-LOC_Os01g52480 | intergenic_region ; MODIFIER | silent_mutation | Average:26.798; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0130154178 | NA | 4.62E-06 | mr1013 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130154178 | NA | 1.24E-06 | mr1015 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130154178 | NA | 2.62E-06 | mr1031 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130154178 | NA | 1.05E-06 | mr1034 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130154178 | NA | 9.96E-06 | mr1056 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130154178 | NA | 2.97E-08 | mr1166 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130154178 | 3.85E-06 | 5.29E-08 | mr1392 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130154178 | 5.21E-07 | 5.21E-07 | mr1392 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130154178 | NA | 5.61E-06 | mr1409 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130154178 | NA | 6.63E-07 | mr1515 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130154178 | NA | 6.14E-07 | mr1765 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |