\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130154178:

Variant ID: vg0130154178 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 30154178
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCTATACACCCCGCACGCTGCTTCTCCTTTTTATTCTCATTGAGATTTTAAAAATCGAATATGTTTATCAATTGGTTTTTTTTTTACTTTCTAGAAGCC[C/T]
CGGCAACCGTCTTGCTCGTCCCTCCTTTTAATCATCATTAGGATTCTATTTGGTGTTTTACTAATAATTTTTATATAACGTATCAACTGCCACCACTATT

Reverse complement sequence

AATAGTGGTGGCAGTTGATACGTTATATAAAAATTATTAGTAAAACACCAAATAGAATCCTAATGATGATTAAAAGGAGGGACGAGCAAGACGGTTGCCG[G/A]
GGCTTCTAGAAAGTAAAAAAAAAACCAATTGATAAACATATTCGATTTTTAAAATCTCAATGAGAATAAAAAGGAGAAGCAGCGTGCGGGGTGTATAGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 12.00% 0.11% 0.00% NA
All Indica  2759 82.90% 17.00% 0.14% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 68.00% 31.60% 0.37% 0.00% NA
Indica I  595 90.90% 9.10% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 70.60% 29.40% 0.00% 0.00% NA
Indica Intermediate  786 81.20% 18.30% 0.51% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130154178 C -> T LOC_Os01g52480.1 upstream_gene_variant ; 1487.0bp to feature; MODIFIER silent_mutation Average:26.798; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0130154178 C -> T LOC_Os01g52490.1 downstream_gene_variant ; 3704.0bp to feature; MODIFIER silent_mutation Average:26.798; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0130154178 C -> T LOC_Os01g52470-LOC_Os01g52480 intergenic_region ; MODIFIER silent_mutation Average:26.798; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130154178 NA 4.62E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130154178 NA 1.24E-06 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130154178 NA 2.62E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130154178 NA 1.05E-06 mr1034 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130154178 NA 9.96E-06 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130154178 NA 2.97E-08 mr1166 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130154178 3.85E-06 5.29E-08 mr1392 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130154178 5.21E-07 5.21E-07 mr1392 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130154178 NA 5.61E-06 mr1409 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130154178 NA 6.63E-07 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130154178 NA 6.14E-07 mr1765 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251