Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130140335:

Variant ID: vg0130140335 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 30140335
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.68, A: 0.32, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


TACAATGTGGAAAGAATTTGATCCAATACGTACTAATGATAAACTATCACATGCTAAATGTATCCACTGCAATAAGGTTTTCGTGGCTAGCCGATCTTCT[G/A]
GGACTAGTTAGTGCCTTAGACATTTGAAAGTTTGTAAGGTCAGGCTTAGAATGCACCATTTGATTGAGCATATGCATGCCAACTTGTCCCCTACCGCTGA

Reverse complement sequence

TCAGCGGTAGGGGACAAGTTGGCATGCATATGCTCAATCAAATGGTGCATTCTAAGCCTGACCTTACAAACTTTCAAATGTCTAAGGCACTAACTAGTCC[C/T]
AGAAGATCGGCTAGCCACGAAAACCTTATTGCAGTGGATACATTTAGCATGTGATAGTTTATCATTAGTACGTATTGGATCAAATTCTTTCCACATTGTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.00% 36.00% 0.02% 0.00% NA
All Indica  2759 97.90% 2.10% 0.04% 0.00% NA
All Japonica  1512 0.80% 99.20% 0.00% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 96.50% 3.40% 0.17% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 96.40% 3.60% 0.00% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 20.80% 79.20% 0.00% 0.00% NA
Intermediate  90 31.10% 68.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130140335 G -> A LOC_Os01g52460.1 downstream_gene_variant ; 2593.0bp to feature; MODIFIER silent_mutation Average:20.828; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg0130140335 G -> A LOC_Os01g52470.1 downstream_gene_variant ; 3240.0bp to feature; MODIFIER silent_mutation Average:20.828; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg0130140335 G -> A LOC_Os01g52460.2 downstream_gene_variant ; 2589.0bp to feature; MODIFIER silent_mutation Average:20.828; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg0130140335 G -> A LOC_Os01g52460-LOC_Os01g52470 intergenic_region ; MODIFIER silent_mutation Average:20.828; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130140335 1.84E-06 8.30E-129 mr1008 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 4.34E-07 5.86E-128 mr1009 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 7.96E-84 mr1014 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 2.93E-83 mr1015 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 1.15E-55 mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 4.90E-70 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 3.75E-81 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 1.94E-76 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 5.32E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 3.26E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 6.89E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 9.54E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 2.59E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 1.28E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 5.53E-88 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 1.29E-35 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 1.74E-23 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 3.72E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 1.63E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 8.02E-34 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 1.44E-82 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 1.41E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 1.78E-10 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 5.39E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 4.96E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 2.04E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 1.30E-08 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 1.79E-101 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 4.42E-08 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 2.38E-06 1.85E-126 mr1008_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 2.36E-92 mr1015_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 3.83E-18 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130140335 NA 5.65E-86 mr1504_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251