\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130107774:

Variant ID: vg0130107774 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 30107774
Reference Allele: TAlternative Allele: C,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TAATGATGTATATTAATCCATGATTAGCGGCTGATTACTGTAGTATCACTGTAGCAAATTATGGATTAATATACCTCGTTAGATTCGTCTCGCAAAATAG[T/C,G]
CTAGGGGTTATGGAATGGGTTTTGGGTTATGGAATGGGTTTTGTCAGTGATCTAGCGGATCCAAACAAGGCCAATAACATAAAACTGCCATCACATGACA

Reverse complement sequence

TGTCATGTGATGGCAGTTTTATGTTATTGGCCTTGTTTGGATCCGCTAGATCACTGACAAAACCCATTCCATAACCCAAAACCCATTCCATAACCCCTAG[A/G,C]
CTATTTTGCGAGACGAATCTAACGAGGTATATTAATCCATAATTTGCTACAGTGATACTACAGTAATCAGCCGCTAATCATGGATTAATATACATCATTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.90% 36.00% 0.06% 0.00% NA
All Indica  2759 97.80% 2.20% 0.00% 0.00% NA
All Japonica  1512 0.70% 99.30% 0.00% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 96.30% 3.70% 0.00% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 19.80% 80.20% 0.00% 0.00% NA
Intermediate  90 34.40% 62.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130107774 T -> G LOC_Os01g52400.1 downstream_gene_variant ; 413.0bp to feature; MODIFIER N Average:91.713; most accessible tissue: Minghui63 flower, score: 94.81 N N N N
vg0130107774 T -> G LOC_Os01g52400.2 downstream_gene_variant ; 413.0bp to feature; MODIFIER N Average:91.713; most accessible tissue: Minghui63 flower, score: 94.81 N N N N
vg0130107774 T -> G LOC_Os01g52400-LOC_Os01g52410 intergenic_region ; MODIFIER N Average:91.713; most accessible tissue: Minghui63 flower, score: 94.81 N N N N
vg0130107774 T -> C LOC_Os01g52400.1 downstream_gene_variant ; 413.0bp to feature; MODIFIER silent_mutation Average:91.713; most accessible tissue: Minghui63 flower, score: 94.81 N N N N
vg0130107774 T -> C LOC_Os01g52400.2 downstream_gene_variant ; 413.0bp to feature; MODIFIER silent_mutation Average:91.713; most accessible tissue: Minghui63 flower, score: 94.81 N N N N
vg0130107774 T -> C LOC_Os01g52400-LOC_Os01g52410 intergenic_region ; MODIFIER silent_mutation Average:91.713; most accessible tissue: Minghui63 flower, score: 94.81 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0130107774 T C -0.07 -0.08 -0.09 -0.03 -0.06 -0.05
vg0130107774 T G -0.03 -0.03 -0.02 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130107774 1.11E-07 2.60E-123 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130107774 5.30E-08 3.42E-122 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130107774 NA 1.34E-77 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130107774 NA 4.47E-79 mr1015 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130107774 NA 2.78E-26 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130107774 NA 4.76E-67 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130107774 NA 4.12E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130107774 1.50E-06 NA mr1486 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130107774 NA 1.18E-86 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130107774 NA 5.94E-37 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130107774 4.92E-08 6.29E-27 mr1548 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130107774 NA 1.53E-21 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130107774 NA 2.40E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130107774 NA 8.86E-69 mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130107774 NA 1.06E-99 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130107774 NA 2.04E-112 mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130107774 NA 5.76E-85 mr1015_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130107774 NA 4.11E-18 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130107774 NA 3.82E-44 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130107774 NA 2.91E-12 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130107774 NA 1.88E-24 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251