\
| Variant ID: vg0130078302 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 30078302 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGCAAATGGGGGCGTCGGAAAAAATGCAATGGGGCAGCCAGGAAGAATAGAACACGCAACCTAAGATTTGCGTGCGTGCGCCTTCACAAGTGAACCAGCA[C/T]
CTCGTTTTGATTTCTTCTGTACAAGTTATATACCGGTTACAATATAACTACGTACAAGTTATATATCGGTTACAATATAACTATAATCAAGTTATAATGT
ACATTATAACTTGATTATAGTTATATTGTAACCGATATATAACTTGTACGTAGTTATATTGTAACCGGTATATAACTTGTACAGAAGAAATCAAAACGAG[G/A]
TGCTGGTTCACTTGTGAAGGCGCACGCACGCAAATCTTAGGTTGCGTGTTCTATTCTTCCTGGCTGCCCCATTGCATTTTTTCCGACGCCCCCATTTGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.20% | 6.80% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 85.80% | 14.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 63.10% | 36.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 21.90% | 78.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 24.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0130078302 | C -> T | LOC_Os01g52340.1 | upstream_gene_variant ; 1347.0bp to feature; MODIFIER | silent_mutation | Average:40.374; most accessible tissue: Callus, score: 84.5 | N | N | N | N |
| vg0130078302 | C -> T | LOC_Os01g52330.1 | downstream_gene_variant ; 1176.0bp to feature; MODIFIER | silent_mutation | Average:40.374; most accessible tissue: Callus, score: 84.5 | N | N | N | N |
| vg0130078302 | C -> T | LOC_Os01g52330-LOC_Os01g52340 | intergenic_region ; MODIFIER | silent_mutation | Average:40.374; most accessible tissue: Callus, score: 84.5 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0130078302 | NA | 1.32E-10 | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130078302 | NA | 5.80E-06 | mr1129_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130078302 | NA | 6.02E-07 | mr1250_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130078302 | NA | 7.57E-06 | mr1438_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130078302 | NA | 3.90E-06 | mr1553_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130078302 | 5.58E-07 | 5.58E-07 | mr1574_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130078302 | NA | 5.76E-06 | mr1781_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |