Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130072231:

Variant ID: vg0130072231 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 30072231
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAGGAATTTAAAACTAACTAAAATTTAGAATAAATAAAATAAAATTAAAAATTTAGTTTAGAGTTCGCATAAAAATACAATTTACAAATAACTAAAATT[C/T]
GAAATTAAAAAAAACATGGAAAGAAGAGTCTAAAGTCATTATAGGAATACAATTTAAAAGTAACTGAAATTCGAAATTAAAAATTAAAGAATATTGAAAG

Reverse complement sequence

CTTTCAATATTCTTTAATTTTTAATTTCGAATTTCAGTTACTTTTAAATTGTATTCCTATAATGACTTTAGACTCTTCTTTCCATGTTTTTTTTAATTTC[G/A]
AATTTTAGTTATTTGTAAATTGTATTTTTATGCGAACTCTAAACTAAATTTTTAATTTTATTTTATTTATTCTAAATTTTAGTTAGTTTTAAATTCCTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.00%	10.80%	5.67%	2.50%	NA
All Indica	2759	86.10%	12.80%	0.80%	0.33%	NA
All Japonica	1512	77.10%	0.10%	15.81%	6.94%	NA
Aus	269	44.60%	55.40%	0.00%	0.00%	NA
Indica I	595	60.70%	37.10%	1.68%	0.50%	NA
Indica II	465	99.60%	0.20%	0.22%	0.00%	NA
Indica III	913	95.80%	3.80%	0.33%	0.00%	NA
Indica Intermediate	786	86.10%	12.10%	1.02%	0.76%	NA
Temperate Japonica	767	67.50%	0.00%	22.56%	9.91%	NA
Tropical Japonica	504	90.50%	0.20%	6.35%	2.98%	NA
Japonica Intermediate	241	79.70%	0.40%	14.11%	5.81%	NA
VI/Aromatic	96	94.80%	4.20%	1.04%	0.00%	NA
Intermediate	90	84.40%	4.40%	6.67%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0130072231	C -> T	LOC_Os01g52330.1	upstream_gene_variant ; 3393.0bp to feature; MODIFIER	silent_mutation	Average:16.208; most accessible tissue: Callus, score: 35.677	N	N	N	N
vg0130072231	C -> T	LOC_Os01g52320.1	downstream_gene_variant ; 2100.0bp to feature; MODIFIER	silent_mutation	Average:16.208; most accessible tissue: Callus, score: 35.677	N	N	N	N
vg0130072231	C -> T	LOC_Os01g52320-LOC_Os01g52330	intergenic_region ; MODIFIER	silent_mutation	Average:16.208; most accessible tissue: Callus, score: 35.677	N	N	N	N
vg0130072231	C -> DEL	N	N	silent_mutation	Average:16.208; most accessible tissue: Callus, score: 35.677	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0130072231	NA	1.99E-14	Plant_height	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0130072231	NA	2.62E-07	mr1070	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231	NA	3.19E-08	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231	NA	4.79E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231	NA	8.16E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231	NA	7.35E-10	mr1839	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231	NA	6.66E-07	mr1909	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231	NA	4.35E-08	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231	NA	4.09E-07	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231	NA	3.15E-08	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231	NA	4.27E-07	mr1204_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231	5.02E-07	NA	mr1244_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231	NA	3.47E-09	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231	NA	1.31E-06	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231	NA	4.46E-06	mr1545_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231	NA	2.67E-06	mr1641_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231	NA	1.69E-14	mr1794_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231	NA	4.61E-06	mr1838_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251