\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130072231:

Variant ID: vg0130072231 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 30072231
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAGGAATTTAAAACTAACTAAAATTTAGAATAAATAAAATAAAATTAAAAATTTAGTTTAGAGTTCGCATAAAAATACAATTTACAAATAACTAAAATT[C/T]
GAAATTAAAAAAAACATGGAAAGAAGAGTCTAAAGTCATTATAGGAATACAATTTAAAAGTAACTGAAATTCGAAATTAAAAATTAAAGAATATTGAAAG

Reverse complement sequence

CTTTCAATATTCTTTAATTTTTAATTTCGAATTTCAGTTACTTTTAAATTGTATTCCTATAATGACTTTAGACTCTTCTTTCCATGTTTTTTTTAATTTC[G/A]
AATTTTAGTTATTTGTAAATTGTATTTTTATGCGAACTCTAAACTAAATTTTTAATTTTATTTTATTTATTCTAAATTTTAGTTAGTTTTAAATTCCTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.00% 10.80% 5.67% 2.50% NA
All Indica  2759 86.10% 12.80% 0.80% 0.33% NA
All Japonica  1512 77.10% 0.10% 15.81% 6.94% NA
Aus  269 44.60% 55.40% 0.00% 0.00% NA
Indica I  595 60.70% 37.10% 1.68% 0.50% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 95.80% 3.80% 0.33% 0.00% NA
Indica Intermediate  786 86.10% 12.10% 1.02% 0.76% NA
Temperate Japonica  767 67.50% 0.00% 22.56% 9.91% NA
Tropical Japonica  504 90.50% 0.20% 6.35% 2.98% NA
Japonica Intermediate  241 79.70% 0.40% 14.11% 5.81% NA
VI/Aromatic  96 94.80% 4.20% 1.04% 0.00% NA
Intermediate  90 84.40% 4.40% 6.67% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130072231 C -> T LOC_Os01g52330.1 upstream_gene_variant ; 3393.0bp to feature; MODIFIER silent_mutation Average:16.208; most accessible tissue: Callus, score: 35.677 N N N N
vg0130072231 C -> T LOC_Os01g52320.1 downstream_gene_variant ; 2100.0bp to feature; MODIFIER silent_mutation Average:16.208; most accessible tissue: Callus, score: 35.677 N N N N
vg0130072231 C -> T LOC_Os01g52320-LOC_Os01g52330 intergenic_region ; MODIFIER silent_mutation Average:16.208; most accessible tissue: Callus, score: 35.677 N N N N
vg0130072231 C -> DEL N N silent_mutation Average:16.208; most accessible tissue: Callus, score: 35.677 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130072231 NA 1.99E-14 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0130072231 NA 2.62E-07 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231 NA 3.19E-08 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231 NA 4.79E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231 NA 8.16E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231 NA 7.35E-10 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231 NA 6.66E-07 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231 NA 4.35E-08 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231 NA 4.09E-07 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231 NA 3.15E-08 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231 NA 4.27E-07 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231 5.02E-07 NA mr1244_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231 NA 3.47E-09 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231 NA 1.31E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231 NA 4.46E-06 mr1545_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231 NA 2.67E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231 NA 1.69E-14 mr1794_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130072231 NA 4.61E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251