Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130044994:

Variant ID: vg0130044994 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 30044994
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

CTGCTGTCTCGAAGACTATATACATTGAGCAATTTTACGGTTCTTGAGGGTGTACCATAAAGTACCATTTTTTCTATTATAAATTTGGTATCTCGTGATA[A/C]
CTAGATACTGTGAGGTACCATGAGGTATCAAAATTTACACTAAAATTTTGGTACCTCATGGTACCTCCTTAAATACCGTAGAATTGCTCATATACATGAT

Reverse complement sequence

ATCATGTATATGAGCAATTCTACGGTATTTAAGGAGGTACCATGAGGTACCAAAATTTTAGTGTAAATTTTGATACCTCATGGTACCTCACAGTATCTAG[T/G]
TATCACGAGATACCAAATTTATAATAGAAAAAATGGTACTTTATGGTACACCCTCAAGAACCGTAAAATTGCTCAATGTATATAGTCTTCGAGACAGCAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.20%	9.20%	3.05%	60.54%	NA
All Indica	2759	3.70%	11.30%	4.35%	80.65%	NA
All Japonica	1512	74.30%	0.30%	0.20%	25.13%	NA
Aus	269	1.50%	40.90%	6.69%	50.93%	NA
Indica I	595	5.90%	15.60%	10.08%	68.40%	NA
Indica II	465	3.90%	14.00%	0.86%	81.29%	NA
Indica III	913	1.30%	2.20%	3.29%	93.21%	NA
Indica Intermediate	786	4.80%	16.90%	3.31%	74.94%	NA
Temperate Japonica	767	98.80%	0.10%	0.00%	1.04%	NA
Tropical Japonica	504	30.40%	0.60%	0.60%	68.45%	NA
Japonica Intermediate	241	88.40%	0.40%	0.00%	11.20%	NA
VI/Aromatic	96	12.50%	5.20%	2.08%	80.21%	NA
Intermediate	90	45.60%	6.70%	1.11%	46.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0130044994	A -> DEL	N	N	silent_mutation	Average:83.269; most accessible tissue: Minghui63 root, score: 97.415	N	N	N	N
vg0130044994	A -> C	LOC_Os01g52250.1	upstream_gene_variant ; 3518.0bp to feature; MODIFIER	silent_mutation	Average:83.269; most accessible tissue: Minghui63 root, score: 97.415	N	N	N	N
vg0130044994	A -> C	LOC_Os01g52270.1	upstream_gene_variant ; 3297.0bp to feature; MODIFIER	silent_mutation	Average:83.269; most accessible tissue: Minghui63 root, score: 97.415	N	N	N	N
vg0130044994	A -> C	LOC_Os01g52250.2	upstream_gene_variant ; 3518.0bp to feature; MODIFIER	silent_mutation	Average:83.269; most accessible tissue: Minghui63 root, score: 97.415	N	N	N	N
vg0130044994	A -> C	LOC_Os01g52250.4	upstream_gene_variant ; 3518.0bp to feature; MODIFIER	silent_mutation	Average:83.269; most accessible tissue: Minghui63 root, score: 97.415	N	N	N	N
vg0130044994	A -> C	LOC_Os01g52250.5	upstream_gene_variant ; 3518.0bp to feature; MODIFIER	silent_mutation	Average:83.269; most accessible tissue: Minghui63 root, score: 97.415	N	N	N	N
vg0130044994	A -> C	LOC_Os01g52250.6	upstream_gene_variant ; 3518.0bp to feature; MODIFIER	silent_mutation	Average:83.269; most accessible tissue: Minghui63 root, score: 97.415	N	N	N	N
vg0130044994	A -> C	LOC_Os01g52250.3	upstream_gene_variant ; 3518.0bp to feature; MODIFIER	silent_mutation	Average:83.269; most accessible tissue: Minghui63 root, score: 97.415	N	N	N	N
vg0130044994	A -> C	LOC_Os01g52260.1	downstream_gene_variant ; 1056.0bp to feature; MODIFIER	silent_mutation	Average:83.269; most accessible tissue: Minghui63 root, score: 97.415	N	N	N	N
vg0130044994	A -> C	LOC_Os01g52260-LOC_Os01g52270	intergenic_region ; MODIFIER	silent_mutation	Average:83.269; most accessible tissue: Minghui63 root, score: 97.415	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0130044994	A	C	0.01	0.02	0.02	0.04	0.02	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0130044994	NA	4.07E-110	mr1008	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130044994	NA	9.47E-110	mr1009	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130044994	NA	3.09E-72	mr1014	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130044994	NA	2.73E-69	mr1027	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130044994	NA	4.19E-12	mr1205	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130044994	NA	1.83E-35	mr1350	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130044994	NA	2.72E-06	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130044994	NA	1.35E-35	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130044994	NA	5.04E-10	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130044994	1.06E-06	NA	mr1244_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251