\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0130029694:

Variant ID: vg0130029694 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 30029694
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTATAGGAAATATGACTTATCCGTAACACTGACAATAATGAATAGGCTTGAACCATGGTATTTTCTTTTCAATATATCAAAGTTACTGCTCCTTCCACTT[C/A,T]
ATCTTGTAAGACACTTTGACTCTCTTTTTTTTTAATCAAACTTTTTAAAGTTTAATCAAATTTATAGAAAAATTAGCAACATGTAAAATATCAAATTAGT

Reverse complement sequence

ACTAATTTGATATTTTACATGTTGCTAATTTTTCTATAAATTTGATTAAACTTTAAAAAGTTTGATTAAAAAAAAAGAGAGTCAAAGTGTCTTACAAGAT[G/T,A]
AAGTGGAAGGAGCAGTAACTTTGATATATTGAAAAGAAAATACCATGGTTCAAGCCTATTCATTATTGTCAGTGTTACGGATAAGTCATATTTCCTATAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.10% 3.90% 0.02% 0.00% T: 0.02%
All Indica  2759 99.00% 1.00% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 44.60% 55.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 96.80% 3.20% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 94.40% 3.30% 1.11% 0.00% T: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0130029694 C -> T LOC_Os01g52230.1 upstream_gene_variant ; 3229.0bp to feature; MODIFIER silent_mutation Average:45.516; most accessible tissue: Callus, score: 89.01 N N N N
vg0130029694 C -> T LOC_Os01g52240.1 upstream_gene_variant ; 1304.0bp to feature; MODIFIER silent_mutation Average:45.516; most accessible tissue: Callus, score: 89.01 N N N N
vg0130029694 C -> T LOC_Os01g52250.1 downstream_gene_variant ; 1303.0bp to feature; MODIFIER silent_mutation Average:45.516; most accessible tissue: Callus, score: 89.01 N N N N
vg0130029694 C -> T LOC_Os01g52250.2 downstream_gene_variant ; 1303.0bp to feature; MODIFIER silent_mutation Average:45.516; most accessible tissue: Callus, score: 89.01 N N N N
vg0130029694 C -> T LOC_Os01g52250.4 downstream_gene_variant ; 1303.0bp to feature; MODIFIER silent_mutation Average:45.516; most accessible tissue: Callus, score: 89.01 N N N N
vg0130029694 C -> T LOC_Os01g52250.5 downstream_gene_variant ; 1303.0bp to feature; MODIFIER silent_mutation Average:45.516; most accessible tissue: Callus, score: 89.01 N N N N
vg0130029694 C -> T LOC_Os01g52250.6 downstream_gene_variant ; 1303.0bp to feature; MODIFIER silent_mutation Average:45.516; most accessible tissue: Callus, score: 89.01 N N N N
vg0130029694 C -> T LOC_Os01g52250.3 downstream_gene_variant ; 1320.0bp to feature; MODIFIER silent_mutation Average:45.516; most accessible tissue: Callus, score: 89.01 N N N N
vg0130029694 C -> T LOC_Os01g52230-LOC_Os01g52250 intergenic_region ; MODIFIER silent_mutation Average:45.516; most accessible tissue: Callus, score: 89.01 N N N N
vg0130029694 C -> A LOC_Os01g52230.1 upstream_gene_variant ; 3229.0bp to feature; MODIFIER silent_mutation Average:45.516; most accessible tissue: Callus, score: 89.01 N N N N
vg0130029694 C -> A LOC_Os01g52240.1 upstream_gene_variant ; 1304.0bp to feature; MODIFIER silent_mutation Average:45.516; most accessible tissue: Callus, score: 89.01 N N N N
vg0130029694 C -> A LOC_Os01g52250.1 downstream_gene_variant ; 1303.0bp to feature; MODIFIER silent_mutation Average:45.516; most accessible tissue: Callus, score: 89.01 N N N N
vg0130029694 C -> A LOC_Os01g52250.2 downstream_gene_variant ; 1303.0bp to feature; MODIFIER silent_mutation Average:45.516; most accessible tissue: Callus, score: 89.01 N N N N
vg0130029694 C -> A LOC_Os01g52250.4 downstream_gene_variant ; 1303.0bp to feature; MODIFIER silent_mutation Average:45.516; most accessible tissue: Callus, score: 89.01 N N N N
vg0130029694 C -> A LOC_Os01g52250.5 downstream_gene_variant ; 1303.0bp to feature; MODIFIER silent_mutation Average:45.516; most accessible tissue: Callus, score: 89.01 N N N N
vg0130029694 C -> A LOC_Os01g52250.6 downstream_gene_variant ; 1303.0bp to feature; MODIFIER silent_mutation Average:45.516; most accessible tissue: Callus, score: 89.01 N N N N
vg0130029694 C -> A LOC_Os01g52250.3 downstream_gene_variant ; 1320.0bp to feature; MODIFIER silent_mutation Average:45.516; most accessible tissue: Callus, score: 89.01 N N N N
vg0130029694 C -> A LOC_Os01g52230-LOC_Os01g52250 intergenic_region ; MODIFIER silent_mutation Average:45.516; most accessible tissue: Callus, score: 89.01 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0130029694 NA 1.78E-11 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130029694 NA 7.65E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130029694 NA 2.95E-38 mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130029694 NA 4.39E-47 mr1550 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130029694 NA 7.80E-06 mr1738 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130029694 6.72E-07 NA mr1244_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130029694 NA 2.22E-30 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0130029694 NA 1.20E-44 mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251