\
| Variant ID: vg0130029694 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 30029694 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTATAGGAAATATGACTTATCCGTAACACTGACAATAATGAATAGGCTTGAACCATGGTATTTTCTTTTCAATATATCAAAGTTACTGCTCCTTCCACTT[C/A,T]
ATCTTGTAAGACACTTTGACTCTCTTTTTTTTTAATCAAACTTTTTAAAGTTTAATCAAATTTATAGAAAAATTAGCAACATGTAAAATATCAAATTAGT
ACTAATTTGATATTTTACATGTTGCTAATTTTTCTATAAATTTGATTAAACTTTAAAAAGTTTGATTAAAAAAAAAGAGAGTCAAAGTGTCTTACAAGAT[G/T,A]
AAGTGGAAGGAGCAGTAACTTTGATATATTGAAAAGAAAATACCATGGTTCAAGCCTATTCATTATTGTCAGTGTTACGGATAAGTCATATTTCCTATAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.10% | 3.90% | 0.02% | 0.00% | T: 0.02% |
| All Indica | 2759 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 44.60% | 55.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 3.30% | 1.11% | 0.00% | T: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0130029694 | C -> T | LOC_Os01g52230.1 | upstream_gene_variant ; 3229.0bp to feature; MODIFIER | silent_mutation | Average:45.516; most accessible tissue: Callus, score: 89.01 | N | N | N | N |
| vg0130029694 | C -> T | LOC_Os01g52240.1 | upstream_gene_variant ; 1304.0bp to feature; MODIFIER | silent_mutation | Average:45.516; most accessible tissue: Callus, score: 89.01 | N | N | N | N |
| vg0130029694 | C -> T | LOC_Os01g52250.1 | downstream_gene_variant ; 1303.0bp to feature; MODIFIER | silent_mutation | Average:45.516; most accessible tissue: Callus, score: 89.01 | N | N | N | N |
| vg0130029694 | C -> T | LOC_Os01g52250.2 | downstream_gene_variant ; 1303.0bp to feature; MODIFIER | silent_mutation | Average:45.516; most accessible tissue: Callus, score: 89.01 | N | N | N | N |
| vg0130029694 | C -> T | LOC_Os01g52250.4 | downstream_gene_variant ; 1303.0bp to feature; MODIFIER | silent_mutation | Average:45.516; most accessible tissue: Callus, score: 89.01 | N | N | N | N |
| vg0130029694 | C -> T | LOC_Os01g52250.5 | downstream_gene_variant ; 1303.0bp to feature; MODIFIER | silent_mutation | Average:45.516; most accessible tissue: Callus, score: 89.01 | N | N | N | N |
| vg0130029694 | C -> T | LOC_Os01g52250.6 | downstream_gene_variant ; 1303.0bp to feature; MODIFIER | silent_mutation | Average:45.516; most accessible tissue: Callus, score: 89.01 | N | N | N | N |
| vg0130029694 | C -> T | LOC_Os01g52250.3 | downstream_gene_variant ; 1320.0bp to feature; MODIFIER | silent_mutation | Average:45.516; most accessible tissue: Callus, score: 89.01 | N | N | N | N |
| vg0130029694 | C -> T | LOC_Os01g52230-LOC_Os01g52250 | intergenic_region ; MODIFIER | silent_mutation | Average:45.516; most accessible tissue: Callus, score: 89.01 | N | N | N | N |
| vg0130029694 | C -> A | LOC_Os01g52230.1 | upstream_gene_variant ; 3229.0bp to feature; MODIFIER | silent_mutation | Average:45.516; most accessible tissue: Callus, score: 89.01 | N | N | N | N |
| vg0130029694 | C -> A | LOC_Os01g52240.1 | upstream_gene_variant ; 1304.0bp to feature; MODIFIER | silent_mutation | Average:45.516; most accessible tissue: Callus, score: 89.01 | N | N | N | N |
| vg0130029694 | C -> A | LOC_Os01g52250.1 | downstream_gene_variant ; 1303.0bp to feature; MODIFIER | silent_mutation | Average:45.516; most accessible tissue: Callus, score: 89.01 | N | N | N | N |
| vg0130029694 | C -> A | LOC_Os01g52250.2 | downstream_gene_variant ; 1303.0bp to feature; MODIFIER | silent_mutation | Average:45.516; most accessible tissue: Callus, score: 89.01 | N | N | N | N |
| vg0130029694 | C -> A | LOC_Os01g52250.4 | downstream_gene_variant ; 1303.0bp to feature; MODIFIER | silent_mutation | Average:45.516; most accessible tissue: Callus, score: 89.01 | N | N | N | N |
| vg0130029694 | C -> A | LOC_Os01g52250.5 | downstream_gene_variant ; 1303.0bp to feature; MODIFIER | silent_mutation | Average:45.516; most accessible tissue: Callus, score: 89.01 | N | N | N | N |
| vg0130029694 | C -> A | LOC_Os01g52250.6 | downstream_gene_variant ; 1303.0bp to feature; MODIFIER | silent_mutation | Average:45.516; most accessible tissue: Callus, score: 89.01 | N | N | N | N |
| vg0130029694 | C -> A | LOC_Os01g52250.3 | downstream_gene_variant ; 1320.0bp to feature; MODIFIER | silent_mutation | Average:45.516; most accessible tissue: Callus, score: 89.01 | N | N | N | N |
| vg0130029694 | C -> A | LOC_Os01g52230-LOC_Os01g52250 | intergenic_region ; MODIFIER | silent_mutation | Average:45.516; most accessible tissue: Callus, score: 89.01 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0130029694 | NA | 1.78E-11 | mr1409 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130029694 | NA | 7.65E-06 | mr1545 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130029694 | NA | 2.95E-38 | mr1549 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130029694 | NA | 4.39E-47 | mr1550 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130029694 | NA | 7.80E-06 | mr1738 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130029694 | 6.72E-07 | NA | mr1244_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130029694 | NA | 2.22E-30 | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0130029694 | NA | 1.20E-44 | mr1550_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |