Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129977730:

Variant ID: vg0129977730 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 29977730
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAATCGTGAAAGATATAATACTTACATCCATATATATGTGCATGTCAGGTAGGCATTTTTACCGGATGTTGCAGCAGGAGGTAAACACCACTTCCAATTC[A/G]
ACCAAAACACTCTCACTCATTTGCCAGAGAGGTTTTTACTCGTGACAAATACTTTTTGATAATGCGACAGATAAATACTAATAGACCGGTCGGTCTGAAA

Reverse complement sequence

TTTCAGACCGACCGGTCTATTAGTATTTATCTGTCGCATTATCAAAAAGTATTTGTCACGAGTAAAAACCTCTCTGGCAAATGAGTGAGAGTGTTTTGGT[T/C]
GAATTGGAAGTGGTGTTTACCTCCTGCTGCAACATCCGGTAAAAATGCCTACCTGACATGCACATATATATGGATGTAAGTATTATATCTTTCACGATTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.60%	25.40%	1.93%	44.05%	NA
All Indica	2759	23.40%	2.70%	1.23%	72.67%	NA
All Japonica	1512	22.40%	72.20%	3.04%	2.38%	NA
Aus	269	92.90%	0.40%	0.74%	5.95%	NA
Indica I	595	39.20%	1.80%	1.18%	57.82%	NA
Indica II	465	1.30%	4.50%	2.58%	91.61%	NA
Indica III	913	26.30%	1.30%	0.44%	71.96%	NA
Indica Intermediate	786	21.20%	3.80%	1.40%	73.54%	NA
Temperate Japonica	767	0.70%	99.20%	0.00%	0.13%	NA
Tropical Japonica	504	62.10%	23.60%	8.13%	6.15%	NA
Japonica Intermediate	241	8.30%	88.00%	2.07%	1.66%	NA
VI/Aromatic	96	91.70%	0.00%	4.17%	4.17%	NA
Intermediate	90	33.30%	37.80%	5.56%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0129977730	A -> G	LOC_Os01g52120-LOC_Os01g52130	intergenic_region ; MODIFIER	silent_mutation	Average:48.779; most accessible tissue: Callus, score: 80.134	N	N	N	N
vg0129977730	A -> DEL	N	N	silent_mutation	Average:48.779; most accessible tissue: Callus, score: 80.134	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0129977730	NA	3.98E-06	mr1277	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129977730	NA	8.51E-88	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129977730	NA	1.23E-07	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129977730	NA	9.73E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129977730	NA	3.09E-11	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129977730	NA	2.94E-07	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129977730	NA	4.01E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129977730	NA	1.30E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129977730	NA	6.15E-16	mr1732	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129977730	NA	3.03E-13	mr1740	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129977730	NA	4.07E-20	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129977730	NA	2.28E-06	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129977730	NA	3.01E-15	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129977730	NA	2.78E-96	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129977730	NA	9.59E-09	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129977730	3.78E-06	1.86E-15	mr1520_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129977730	NA	1.15E-16	mr1539_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129977730	NA	5.84E-16	mr1539_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129977730	NA	1.13E-16	mr1540_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129977730	NA	4.30E-17	mr1540_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129977730	NA	1.72E-07	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129977730	NA	9.19E-06	mr1715_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129977730	NA	2.97E-16	mr1732_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129977730	NA	2.14E-15	mr1732_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129977730	NA	4.08E-14	mr1790_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129977730	NA	5.81E-41	mr1805_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251