Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0129974508:

Variant ID: vg0129974508 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 29974508
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGTATTTATCAAAGTTTGACAATAAACTAAATGTTAACATTTTTTTATAACTTTACTTTAAAAAAATAGTATAGATGAAAATAACATCAATTTGAACTG[C/T]
CCTTAGCCTTGGATTGATTGATCATCGTCCTTGTGTTTCCTATTGGCTACTACAGCCTACAGGATGTGGTTTTCATTTTTGCATTTGATTCTGCGTTCGG

Reverse complement sequence

CCGAACGCAGAATCAAATGCAAAAATGAAAACCACATCCTGTAGGCTGTAGTAGCCAATAGGAAACACAAGGACGATGATCAATCAATCCAAGGCTAAGG[G/A]
CAGTTCAAATTGATGTTATTTTCATCTATACTATTTTTTTAAAGTAAAGTTATAAAAAAATGTTAACATTTAGTTTATTGTCAAACTTTGATAAATACAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.60%	10.30%	0.04%	0.00%	NA
All Indica	2759	90.10%	9.80%	0.07%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	24.20%	75.80%	0.00%	0.00%	NA
Indica I	595	97.80%	2.20%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	82.00%	17.90%	0.11%	0.00%	NA
Indica Intermediate	786	88.30%	11.60%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0129974508	C -> T	LOC_Os01g52110.1	upstream_gene_variant ; 3741.0bp to feature; MODIFIER	silent_mutation	Average:81.027; most accessible tissue: Callus, score: 98.424	N	N	N	N
vg0129974508	C -> T	LOC_Os01g52110.3	upstream_gene_variant ; 3758.0bp to feature; MODIFIER	silent_mutation	Average:81.027; most accessible tissue: Callus, score: 98.424	N	N	N	N
vg0129974508	C -> T	LOC_Os01g52110.8	upstream_gene_variant ; 3742.0bp to feature; MODIFIER	silent_mutation	Average:81.027; most accessible tissue: Callus, score: 98.424	N	N	N	N
vg0129974508	C -> T	LOC_Os01g52110.2	upstream_gene_variant ; 3741.0bp to feature; MODIFIER	silent_mutation	Average:81.027; most accessible tissue: Callus, score: 98.424	N	N	N	N
vg0129974508	C -> T	LOC_Os01g52110.4	upstream_gene_variant ; 3741.0bp to feature; MODIFIER	silent_mutation	Average:81.027; most accessible tissue: Callus, score: 98.424	N	N	N	N
vg0129974508	C -> T	LOC_Os01g52110.5	upstream_gene_variant ; 3741.0bp to feature; MODIFIER	silent_mutation	Average:81.027; most accessible tissue: Callus, score: 98.424	N	N	N	N
vg0129974508	C -> T	LOC_Os01g52110.7	upstream_gene_variant ; 3741.0bp to feature; MODIFIER	silent_mutation	Average:81.027; most accessible tissue: Callus, score: 98.424	N	N	N	N
vg0129974508	C -> T	LOC_Os01g52110.9	upstream_gene_variant ; 3741.0bp to feature; MODIFIER	silent_mutation	Average:81.027; most accessible tissue: Callus, score: 98.424	N	N	N	N
vg0129974508	C -> T	LOC_Os01g52120.1	downstream_gene_variant ; 2473.0bp to feature; MODIFIER	silent_mutation	Average:81.027; most accessible tissue: Callus, score: 98.424	N	N	N	N
vg0129974508	C -> T	LOC_Os01g52120-LOC_Os01g52130	intergenic_region ; MODIFIER	silent_mutation	Average:81.027; most accessible tissue: Callus, score: 98.424	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0129974508	C	T	0.01	0.02	0.01	-0.02	0.01	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0129974508	NA	9.20E-06	mr1054	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508	NA	3.54E-07	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508	NA	3.56E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508	NA	6.31E-07	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508	2.15E-06	2.15E-06	mr1459	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508	NA	6.82E-06	mr1564	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508	NA	4.98E-06	mr1568	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508	NA	2.96E-07	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508	NA	2.42E-12	mr1649	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508	NA	8.64E-11	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508	NA	1.78E-06	mr1759	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508	NA	4.93E-06	mr1787	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508	NA	3.81E-06	mr1952	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508	NA	3.74E-11	mr1510_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508	NA	1.10E-08	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508	NA	5.39E-18	mr1587_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508	NA	1.86E-06	mr1762_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251