\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129974508:

Variant ID: vg0129974508 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 29974508
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGTATTTATCAAAGTTTGACAATAAACTAAATGTTAACATTTTTTTATAACTTTACTTTAAAAAAATAGTATAGATGAAAATAACATCAATTTGAACTG[C/T]
CCTTAGCCTTGGATTGATTGATCATCGTCCTTGTGTTTCCTATTGGCTACTACAGCCTACAGGATGTGGTTTTCATTTTTGCATTTGATTCTGCGTTCGG

Reverse complement sequence

CCGAACGCAGAATCAAATGCAAAAATGAAAACCACATCCTGTAGGCTGTAGTAGCCAATAGGAAACACAAGGACGATGATCAATCAATCCAAGGCTAAGG[G/A]
CAGTTCAAATTGATGTTATTTTCATCTATACTATTTTTTTAAAGTAAAGTTATAAAAAAATGTTAACATTTAGTTTATTGTCAAACTTTGATAAATACAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.60% 10.30% 0.04% 0.00% NA
All Indica  2759 90.10% 9.80% 0.07% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 24.20% 75.80% 0.00% 0.00% NA
Indica I  595 97.80% 2.20% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 82.00% 17.90% 0.11% 0.00% NA
Indica Intermediate  786 88.30% 11.60% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0129974508 C -> T LOC_Os01g52110.1 upstream_gene_variant ; 3741.0bp to feature; MODIFIER silent_mutation Average:81.027; most accessible tissue: Callus, score: 98.424 N N N N
vg0129974508 C -> T LOC_Os01g52110.3 upstream_gene_variant ; 3758.0bp to feature; MODIFIER silent_mutation Average:81.027; most accessible tissue: Callus, score: 98.424 N N N N
vg0129974508 C -> T LOC_Os01g52110.8 upstream_gene_variant ; 3742.0bp to feature; MODIFIER silent_mutation Average:81.027; most accessible tissue: Callus, score: 98.424 N N N N
vg0129974508 C -> T LOC_Os01g52110.2 upstream_gene_variant ; 3741.0bp to feature; MODIFIER silent_mutation Average:81.027; most accessible tissue: Callus, score: 98.424 N N N N
vg0129974508 C -> T LOC_Os01g52110.4 upstream_gene_variant ; 3741.0bp to feature; MODIFIER silent_mutation Average:81.027; most accessible tissue: Callus, score: 98.424 N N N N
vg0129974508 C -> T LOC_Os01g52110.5 upstream_gene_variant ; 3741.0bp to feature; MODIFIER silent_mutation Average:81.027; most accessible tissue: Callus, score: 98.424 N N N N
vg0129974508 C -> T LOC_Os01g52110.7 upstream_gene_variant ; 3741.0bp to feature; MODIFIER silent_mutation Average:81.027; most accessible tissue: Callus, score: 98.424 N N N N
vg0129974508 C -> T LOC_Os01g52110.9 upstream_gene_variant ; 3741.0bp to feature; MODIFIER silent_mutation Average:81.027; most accessible tissue: Callus, score: 98.424 N N N N
vg0129974508 C -> T LOC_Os01g52120.1 downstream_gene_variant ; 2473.0bp to feature; MODIFIER silent_mutation Average:81.027; most accessible tissue: Callus, score: 98.424 N N N N
vg0129974508 C -> T LOC_Os01g52120-LOC_Os01g52130 intergenic_region ; MODIFIER silent_mutation Average:81.027; most accessible tissue: Callus, score: 98.424 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0129974508 C T 0.01 0.02 0.01 -0.02 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0129974508 NA 9.20E-06 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508 NA 3.54E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508 NA 3.56E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508 NA 6.31E-07 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508 2.15E-06 2.15E-06 mr1459 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508 NA 6.82E-06 mr1564 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508 NA 4.98E-06 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508 NA 2.96E-07 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508 NA 2.42E-12 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508 NA 8.64E-11 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508 NA 1.78E-06 mr1759 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508 NA 4.93E-06 mr1787 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508 NA 3.81E-06 mr1952 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508 NA 3.74E-11 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508 NA 1.10E-08 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508 NA 5.39E-18 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129974508 NA 1.86E-06 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251