\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129959121:

Variant ID: vg0129959121 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 29959121
Reference Allele: GATTAAlternative Allele: AATTA,G
Primary Allele: AATTASecondary Allele: GATTA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGGGGATGACGTCTCGGGCGGTATCGCTCGACGAGAGCGAGACCGTTCGGTCTCGCAGAAACAATTAGCGACATTGTCAATAGGATTCATTTGATTAGT[GATTA/AATTA,G]
ATTACTTAATTAACAATTAACTAATAATAATTAGTGATAATCAGGATAATTAACTGCTAATTAAATCGGCAAGGCACGCTATCGCTCTTTGCTTGGGCGA

Reverse complement sequence

TCGCCCAAGCAAAGAGCGATAGCGTGCCTTGCCGATTTAATTAGCAGTTAATTATCCTGATTATCACTAATTATTATTAGTTAATTGTTAATTAAGTAAT[TAATC/TAATT,C]
ACTAATCAAATGAATCCTATTGACAATGTCGCTAATTGTTTCTGCGAGACCGAACGGTCTCGCTCTCGTCGAGCGATACCGCCCGAGACGTCATCCCCGC

Allele Frequencies:

Populations Population SizeFrequency of AATTA(primary allele) Frequency of GATTA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.30% 41.40% 4.99% 5.25% G: 0.02%
All Indica  2759 79.10% 3.60% 8.41% 8.88% NA
All Japonica  1512 0.80% 99.10% 0.07% 0.00% G: 0.07%
Aus  269 20.40% 78.80% 0.00% 0.74% NA
Indica I  595 85.90% 0.20% 8.91% 5.04% NA
Indica II  465 74.60% 1.70% 12.26% 11.40% NA
Indica III  913 80.80% 5.00% 4.38% 9.75% NA
Indica Intermediate  786 74.70% 5.60% 10.43% 9.29% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 98.60% 0.20% 0.00% G: 0.20%
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 15.60% 84.40% 0.00% 0.00% NA
Intermediate  90 22.20% 73.30% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0129959121 GATTA -> G LOC_Os01g52100.1 upstream_gene_variant ; 1572.0bp to feature; MODIFIER silent_mutation Average:82.304; most accessible tissue: Zhenshan97 flag leaf, score: 96.085 N N N N
vg0129959121 GATTA -> G LOC_Os01g52090-LOC_Os01g52100 intergenic_region ; MODIFIER silent_mutation Average:82.304; most accessible tissue: Zhenshan97 flag leaf, score: 96.085 N N N N
vg0129959121 GATTA -> DEL N N silent_mutation Average:82.304; most accessible tissue: Zhenshan97 flag leaf, score: 96.085 N N N N
vg0129959121 GATTA -> AATTA LOC_Os01g52100.1 upstream_gene_variant ; 1573.0bp to feature; MODIFIER silent_mutation Average:82.304; most accessible tissue: Zhenshan97 flag leaf, score: 96.085 N N N N
vg0129959121 GATTA -> AATTA LOC_Os01g52090-LOC_Os01g52100 intergenic_region ; MODIFIER silent_mutation Average:82.304; most accessible tissue: Zhenshan97 flag leaf, score: 96.085 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0129959121 GATTA AATTA -0.02 0.0 0.01 -0.01 -0.01 -0.01
vg0129959121 GATTA G 0.16 -0.1 -0.15 0.01 0.08 0.13

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0129959121 NA 1.96E-23 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 6.23E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 1.11E-23 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 1.87E-48 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 4.01E-58 mr1088 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 1.36E-48 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 3.17E-29 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 3.09E-13 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 1.04E-21 mr1416 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 4.10E-42 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 6.00E-25 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 1.51E-19 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 2.55E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 1.14E-12 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 9.22E-60 mr1671 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 5.77E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 9.14E-13 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 4.29E-32 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 2.09E-28 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 1.13E-23 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 7.97E-12 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 4.89E-16 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 2.87E-11 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 1.49E-27 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 4.55E-65 mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 3.22E-78 mr1088_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 3.07E-59 mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 1.41E-63 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 9.36E-39 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 4.66E-37 mr1224_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 1.34E-22 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 9.59E-27 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 1.36E-13 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 4.44E-51 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 8.99E-52 mr1509_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 2.09E-21 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 5.50E-63 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 1.85E-18 mr1581_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 2.28E-14 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 4.61E-48 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 3.58E-17 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 1.60E-39 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 5.21E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121 NA 5.73E-97 mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251