Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129959121:

Variant ID: vg0129959121 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 29959121
Reference Allele: GATTA	Alternative Allele: AATTA,G
Primary Allele: AATTA	Secondary Allele: GATTA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCGGGGATGACGTCTCGGGCGGTATCGCTCGACGAGAGCGAGACCGTTCGGTCTCGCAGAAACAATTAGCGACATTGTCAATAGGATTCATTTGATTAGT[GATTA/AATTA,G]
ATTACTTAATTAACAATTAACTAATAATAATTAGTGATAATCAGGATAATTAACTGCTAATTAAATCGGCAAGGCACGCTATCGCTCTTTGCTTGGGCGA

Reverse complement sequence

TCGCCCAAGCAAAGAGCGATAGCGTGCCTTGCCGATTTAATTAGCAGTTAATTATCCTGATTATCACTAATTATTATTAGTTAATTGTTAATTAAGTAAT[TAATC/TAATT,C]
ACTAATCAAATGAATCCTATTGACAATGTCGCTAATTGTTTCTGCGAGACCGAACGGTCTCGCTCTCGTCGAGCGATACCGCCCGAGACGTCATCCCCGC

Allele Frequencies:

Populations	Population Size	Frequency of AATTA(primary allele)	Frequency of GATTA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.30%	41.40%	4.99%	5.25%	G: 0.02%
All Indica	2759	79.10%	3.60%	8.41%	8.88%	NA
All Japonica	1512	0.80%	99.10%	0.07%	0.00%	G: 0.07%
Aus	269	20.40%	78.80%	0.00%	0.74%	NA
Indica I	595	85.90%	0.20%	8.91%	5.04%	NA
Indica II	465	74.60%	1.70%	12.26%	11.40%	NA
Indica III	913	80.80%	5.00%	4.38%	9.75%	NA
Indica Intermediate	786	74.70%	5.60%	10.43%	9.29%	NA
Temperate Japonica	767	0.10%	99.90%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	98.60%	0.20%	0.00%	G: 0.20%
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	15.60%	84.40%	0.00%	0.00%	NA
Intermediate	90	22.20%	73.30%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0129959121	GATTA -> G	LOC_Os01g52100.1	upstream_gene_variant ; 1572.0bp to feature; MODIFIER	silent_mutation	Average:82.304; most accessible tissue: Zhenshan97 flag leaf, score: 96.085	N	N	N	N
vg0129959121	GATTA -> G	LOC_Os01g52090-LOC_Os01g52100	intergenic_region ; MODIFIER	silent_mutation	Average:82.304; most accessible tissue: Zhenshan97 flag leaf, score: 96.085	N	N	N	N
vg0129959121	GATTA -> DEL	N	N	silent_mutation	Average:82.304; most accessible tissue: Zhenshan97 flag leaf, score: 96.085	N	N	N	N
vg0129959121	GATTA -> AATTA	LOC_Os01g52100.1	upstream_gene_variant ; 1573.0bp to feature; MODIFIER	silent_mutation	Average:82.304; most accessible tissue: Zhenshan97 flag leaf, score: 96.085	N	N	N	N
vg0129959121	GATTA -> AATTA	LOC_Os01g52090-LOC_Os01g52100	intergenic_region ; MODIFIER	silent_mutation	Average:82.304; most accessible tissue: Zhenshan97 flag leaf, score: 96.085	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0129959121	GATTA	AATTA	-0.02	0.0	0.01	-0.01	-0.01	-0.01
vg0129959121	GATTA	G	0.16	-0.1	-0.15	0.01	0.08	0.13

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0129959121	NA	1.96E-23	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	6.23E-09	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	1.11E-23	mr1051	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	1.87E-48	mr1063	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	4.01E-58	mr1088	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	1.36E-48	mr1125	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	3.17E-29	mr1208	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	3.09E-13	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	1.04E-21	mr1416	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	4.10E-42	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	6.00E-25	mr1551	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	1.51E-19	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	2.55E-11	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	1.14E-12	mr1655	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	9.22E-60	mr1671	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	5.77E-11	mr1713	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	9.14E-13	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	4.29E-32	mr1745	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	2.09E-28	mr1793	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	1.13E-23	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	7.97E-12	mr1883	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	4.89E-16	mr1916	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	2.87E-11	mr1938	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	1.49E-27	mr1051_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	4.55E-65	mr1078_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	3.22E-78	mr1088_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	3.07E-59	mr1096_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	1.41E-63	mr1125_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	9.36E-39	mr1208_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	4.66E-37	mr1224_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	1.34E-22	mr1316_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	9.59E-27	mr1323_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	1.36E-13	mr1326_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	4.44E-51	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	8.99E-52	mr1509_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	2.09E-21	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	5.50E-63	mr1558_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	1.85E-18	mr1581_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	2.28E-14	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	4.61E-48	mr1721_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	3.58E-17	mr1744_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	1.60E-39	mr1745_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	5.21E-10	mr1782_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129959121	NA	5.73E-97	mr1973_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251