\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129921541:

Variant ID: vg0129921541 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 29921541
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGGTCGACATACAATAGGTAACTTTAGACACTAAAAATCTATTAAATTTCCTACAAACGCTTCTAAATAGCCATTTGGCGCTTCTACGAACGGTTCTAC[G/A]
CCACCATGTGGTGCTCTAATAAATTAGAGAAAACCTTACAAATTGTGAGAAAAAAATCATGCAATCATTTTTATTGGTTGACCTACTATTTTAAAATATT

Reverse complement sequence

AATATTTTAAAATAGTAGGTCAACCAATAAAAATGATTGCATGATTTTTTTCTCACAATTTGTAAGGTTTTCTCTAATTTATTAGAGCACCACATGGTGG[C/T]
GTAGAACCGTTCGTAGAAGCGCCAAATGGCTATTTAGAAGCGTTTGTAGGAAATTTAATAGATTTTTAGTGTCTAAAGTTACCTATTGTATGTCGACCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.70% 24.60% 4.27% 1.50% NA
All Indica  2759 89.50% 2.00% 6.34% 2.17% NA
All Japonica  1512 28.10% 70.30% 0.86% 0.73% NA
Aus  269 95.20% 2.20% 2.60% 0.00% NA
Indica I  595 91.30% 1.50% 5.38% 1.85% NA
Indica II  465 76.80% 4.10% 13.76% 5.38% NA
Indica III  913 96.50% 0.40% 1.97% 1.10% NA
Indica Intermediate  786 87.40% 3.10% 7.76% 1.78% NA
Temperate Japonica  767 0.70% 96.70% 1.30% 1.30% NA
Tropical Japonica  504 78.20% 21.60% 0.20% 0.00% NA
Japonica Intermediate  241 10.80% 88.00% 0.83% 0.41% NA
VI/Aromatic  96 95.80% 2.10% 2.08% 0.00% NA
Intermediate  90 56.70% 37.80% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0129921541 G -> A LOC_Os01g52030-LOC_Os01g52050 intergenic_region ; MODIFIER silent_mutation Average:26.836; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0129921541 G -> DEL N N silent_mutation Average:26.836; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0129921541 NA 3.21E-07 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129921541 1.93E-07 3.58E-15 mr1539 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129921541 NA 1.79E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129921541 5.69E-06 1.55E-19 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129921541 NA 2.74E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129921541 NA 1.59E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129921541 NA 7.07E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129921541 NA 4.97E-08 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129921541 NA 4.53E-19 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129921541 NA 2.28E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129921541 NA 2.94E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129921541 NA 1.08E-07 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129921541 NA 5.08E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129921541 NA 1.83E-07 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129921541 NA 3.01E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129921541 NA 9.23E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129921541 3.12E-07 3.52E-20 mr1539_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129921541 NA 2.19E-16 mr1539_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129921541 NA 1.28E-17 mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129921541 NA 6.08E-17 mr1540_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129921541 NA 2.02E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129921541 NA 3.79E-18 mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129921541 NA 3.49E-16 mr1732_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251