\
| Variant ID: vg0129901522 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 29901522 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GAAGCCCCGCCGCCACCGTCCCTGCGGCCGCGCGACTTTGCCGGCGCCCGCTCAGGCGGCGGCGAGGCAGAGAAGGAGGGGAGGAGGAGGAAGAAGACGG[T/C]
GGCGGCGTCACCTCTCGTGTCGCCCGTGGAGAGGGCGATGCGAGAGCCCTTTCCCTGGAGTAGATAGTTTTGCTTGTCTGCTTTGTGTCCGTTCTGTTTA
TAAACAGAACGGACACAAAGCAGACAAGCAAAACTATCTACTCCAGGGAAAGGGCTCTCGCATCGCCCTCTCCACGGGCGACACGAGAGGTGACGCCGCC[A/G]
CCGTCTTCTTCCTCCTCCTCCCCTCCTTCTCTGCCTCGCCGCCGCCTGAGCGGGCGCCGGCAAAGTCGCGCGGCCGCAGGGACGGTGGCGGCGGGGCTTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.10% | 27.70% | 0.13% | 0.04% | NA |
| All Indica | 2759 | 80.30% | 19.50% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 73.80% | 26.10% | 0.00% | 0.13% | NA |
| Aus | 269 | 5.60% | 94.10% | 0.37% | 0.00% | NA |
| Indica I | 595 | 62.50% | 37.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 81.60% | 18.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 81.20% | 18.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 26.80% | 72.80% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 35.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0129901522 | T -> DEL | N | N | silent_mutation | Average:63.586; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 | N | N | N | N |
| vg0129901522 | T -> C | LOC_Os01g52010.1 | downstream_gene_variant ; 3055.0bp to feature; MODIFIER | silent_mutation | Average:63.586; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 | N | N | N | N |
| vg0129901522 | T -> C | LOC_Os01g52030.1 | downstream_gene_variant ; 2582.0bp to feature; MODIFIER | silent_mutation | Average:63.586; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 | N | N | N | N |
| vg0129901522 | T -> C | LOC_Os01g52020.1 | intron_variant ; MODIFIER | silent_mutation | Average:63.586; most accessible tissue: Zhenshan97 flag leaf, score: 75.761 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0129901522 | NA | 8.03E-30 | Plant_height | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0129901522 | NA | 4.20E-16 | Plant_height | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0129901522 | NA | 1.12E-06 | mr1031 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 1.62E-06 | mr1056 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 3.32E-06 | mr1097 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 2.27E-06 | mr1219 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 4.61E-06 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 1.28E-07 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 2.15E-06 | mr1706 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 4.11E-07 | mr1839 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 1.88E-06 | mr1909 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 3.43E-14 | mr1942 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 8.80E-06 | mr1045_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 5.57E-06 | mr1060_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 3.38E-07 | mr1060_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 2.07E-07 | mr1064_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 1.95E-06 | mr1097_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 2.48E-06 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 1.00E-06 | mr1268_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 4.97E-06 | mr1295_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 2.53E-09 | mr1319_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 3.32E-06 | mr1320_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 3.68E-13 | mr1330_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 2.33E-06 | mr1358_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 1.08E-11 | mr1378_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 2.25E-06 | mr1428_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 8.99E-06 | mr1431_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 1.10E-06 | mr1528_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 5.07E-06 | mr1528_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 1.49E-15 | mr1539_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 1.54E-17 | mr1540_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 1.92E-07 | mr1545_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 8.25E-06 | mr1624_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 3.89E-06 | mr1636_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 3.94E-06 | mr1715_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 2.81E-16 | mr1732_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 1.06E-07 | mr1735_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 1.61E-10 | mr1758_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 4.41E-18 | mr1794_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 1.09E-07 | mr1815_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 3.77E-12 | mr1942_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 2.25E-06 | mr1959_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129901522 | NA | 7.66E-06 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |