\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129899993:

Variant ID: vg0129899993 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 29899993
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCATGGCACTTCTCCCGCCGCATTTCTCCTTGACTAATCCCGGAGTAGATAGTTTTTTTTAACGACTCGCACGAGACGGTGCGAAGTTCTATTGATAGAG[C/T,A]
AGGAAAAAATTATAAGATTATAACCCTGGAGGGTCATAACCAGGAAAAAAGAAAAAAATATACAACCCCACACACCTACAGCGCCAACACACACGACCAG

Reverse complement sequence

CTGGTCGTGTGTGTTGGCGCTGTAGGTGTGTGGGGTTGTATATTTTTTTCTTTTTTCCTGGTTATGACCCTCCAGGGTTATAATCTTATAATTTTTTCCT[G/A,T]
CTCTATCAATAGAACTTCGCACCGTCTCGTGCGAGTCGTTAAAAAAAACTATCTACTCCGGGATTAGTCAAGGAGAAATGCGGCGGGAGAAGTGCCATGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.10% 18.80% 0.00% 0.00% A: 0.02%
All Indica  2759 80.80% 19.10% 0.00% 0.00% A: 0.04%
All Japonica  1512 99.20% 0.80% 0.00% 0.00% NA
Aus  269 9.70% 90.30% 0.00% 0.00% NA
Indica I  595 63.50% 36.30% 0.00% 0.00% A: 0.17%
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 81.90% 18.10% 0.00% 0.00% NA
Indica Intermediate  786 81.70% 18.30% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0129899993 C -> T LOC_Os01g52010.1 downstream_gene_variant ; 1526.0bp to feature; MODIFIER silent_mutation Average:68.151; most accessible tissue: Callus, score: 91.22 N N N N
vg0129899993 C -> T LOC_Os01g52020.1 downstream_gene_variant ; 313.0bp to feature; MODIFIER silent_mutation Average:68.151; most accessible tissue: Callus, score: 91.22 N N N N
vg0129899993 C -> T LOC_Os01g52030.1 downstream_gene_variant ; 4111.0bp to feature; MODIFIER silent_mutation Average:68.151; most accessible tissue: Callus, score: 91.22 N N N N
vg0129899993 C -> T LOC_Os01g52010-LOC_Os01g52020 intergenic_region ; MODIFIER silent_mutation Average:68.151; most accessible tissue: Callus, score: 91.22 N N N N
vg0129899993 C -> A LOC_Os01g52010.1 downstream_gene_variant ; 1526.0bp to feature; MODIFIER N Average:68.151; most accessible tissue: Callus, score: 91.22 N N N N
vg0129899993 C -> A LOC_Os01g52020.1 downstream_gene_variant ; 313.0bp to feature; MODIFIER N Average:68.151; most accessible tissue: Callus, score: 91.22 N N N N
vg0129899993 C -> A LOC_Os01g52030.1 downstream_gene_variant ; 4111.0bp to feature; MODIFIER N Average:68.151; most accessible tissue: Callus, score: 91.22 N N N N
vg0129899993 C -> A LOC_Os01g52010-LOC_Os01g52020 intergenic_region ; MODIFIER N Average:68.151; most accessible tissue: Callus, score: 91.22 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0129899993 NA 4.31E-26 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0129899993 NA 4.25E-17 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0129899993 NA 4.68E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 8.43E-07 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 2.69E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 1.72E-06 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 3.58E-06 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 2.19E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 1.10E-06 mr1706 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 1.51E-07 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 9.24E-07 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 2.03E-06 mr1045_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 7.35E-07 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 5.58E-07 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 4.49E-07 mr1064_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 2.39E-07 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 1.73E-11 mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 1.18E-07 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 2.21E-06 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 5.74E-07 mr1320_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 5.24E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 3.26E-09 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 1.26E-06 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 3.13E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 1.49E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 2.68E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 2.08E-06 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 1.02E-09 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 4.18E-06 mr1528_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 3.68E-08 mr1545_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 2.01E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 2.17E-06 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 6.35E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 2.34E-08 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 1.39E-09 mr1743_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 8.95E-09 mr1758_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 4.32E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129899993 NA 2.46E-06 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251