\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129866460:

Variant ID: vg0129866460 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 29866460
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCACATTGATATTCGTTTTCACTTTTTGAGGGATCATGTTGAGAAGGGAGATGTTGAATTGTAGTTTTTGGACACAAAGTTGCAAATTGCTGATATTTT[C/T]
ACTAAATCTTTGGATTCTAATCGTTTTGCTTTTCTTCATGGTGAATTGGGAATAATTCATCCTTTTGGCATGGTTTGAGGGGGAGTTTGTACCTCATGGT

Reverse complement sequence

ACCATGAGGTACAAACTCCCCCTCAAACCATGCCAAAAGGATGAATTATTCCCAATTCACCATGAAGAAAAGCAAAACGATTAGAATCCAAAGATTTAGT[G/A]
AAAATATCAGCAATTTGCAACTTTGTGTCCAAAAACTACAATTCAACATCTCCCTTCTCAACATGATCCCTCAAAAAGTGAAAACGAATATCAATGTGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.00% 9.00% 18.15% 10.79% NA
All Indica  2759 51.60% 0.30% 30.16% 17.98% NA
All Japonica  1512 73.30% 25.60% 0.60% 0.53% NA
Aus  269 92.90% 3.70% 2.23% 1.12% NA
Indica I  595 61.30% 0.20% 27.56% 10.92% NA
Indica II  465 46.90% 0.00% 35.27% 17.85% NA
Indica III  913 46.10% 0.40% 29.35% 24.10% NA
Indica Intermediate  786 53.30% 0.40% 30.03% 16.28% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 24.60% 72.20% 1.79% 1.39% NA
Japonica Intermediate  241 92.10% 7.50% 0.00% 0.41% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 66.70% 17.80% 12.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0129866460 C -> T LOC_Os01g51970.1 upstream_gene_variant ; 4704.0bp to feature; MODIFIER silent_mutation Average:15.184; most accessible tissue: Zhenshan97 flower, score: 23.247 N N N N
vg0129866460 C -> T LOC_Os01g51950.1 downstream_gene_variant ; 36.0bp to feature; MODIFIER silent_mutation Average:15.184; most accessible tissue: Zhenshan97 flower, score: 23.247 N N N N
vg0129866460 C -> T LOC_Os01g51960.1 downstream_gene_variant ; 2448.0bp to feature; MODIFIER silent_mutation Average:15.184; most accessible tissue: Zhenshan97 flower, score: 23.247 N N N N
vg0129866460 C -> T LOC_Os01g51950-LOC_Os01g51960 intergenic_region ; MODIFIER silent_mutation Average:15.184; most accessible tissue: Zhenshan97 flower, score: 23.247 N N N N
vg0129866460 C -> DEL N N silent_mutation Average:15.184; most accessible tissue: Zhenshan97 flower, score: 23.247 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0129866460 NA 1.34E-08 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129866460 NA 1.86E-10 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129866460 NA 9.44E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129866460 NA 2.10E-08 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129866460 NA 5.24E-09 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129866460 NA 8.98E-15 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129866460 NA 1.49E-11 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129866460 NA 3.61E-10 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129866460 NA 1.15E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129866460 NA 1.15E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129866460 NA 9.85E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129866460 2.69E-07 NA mr1539_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129866460 NA 1.62E-16 mr1539_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129866460 6.15E-08 NA mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129866460 NA 1.18E-18 mr1540_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129866460 NA 2.32E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129866460 NA 1.53E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129866460 NA 7.51E-29 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129866460 NA 7.84E-06 mr1715_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129866460 1.49E-08 NA mr1732_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129866460 9.16E-06 8.70E-18 mr1732_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251