\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129864706:

Variant ID: vg0129864706 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 29864706
Reference Allele: CAlternative Allele: CCGGT,T,CGGT
Primary Allele: CCGGTSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACACTGTCACAGGTTCAGGGGGAGGATGGTCGTATTTTTTAAGACGAGAGCGATGACAACGACGACGACGAGGTCGGCTCAGCTGGTCAGACCGGGCGC[C/CCGGT,T,CGGT]
AGGCCGGTCCGACCGCCGGCACACCTCCGGACAGACCGGCCCATGAGGAGCGGTCAAACTGGCCAGGTTCGTCGGGTTCCGGTACTGTTGATGCTGATCG

Reverse complement sequence

CGATCAGCATCAACAGTACCGGAACCCGACGAACCTGGCCAGTTTGACCGCTCCTCATGGGCCGGTCTGTCCGGAGGTGTGCCGGCGGTCGGACCGGCCT[G/ACCGG,A,ACCG]
GCGCCCGGTCTGACCAGCTGAGCCGACCTCGTCGTCGTCGTTGTCATCGCTCTCGTCTTAAAAAATACGACCATCCTCCCCCTGAACCTGTGACAGTGTA

Allele Frequencies:

Populations Population SizeFrequency of CCGGT(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.80% 29.80% 0.30% 0.00% T: 24.08%; CGGT: 0.08%
All Indica  2759 76.10% 10.20% 0.36% 0.00% T: 13.19%; CGGT: 0.14%
All Japonica  1512 1.90% 72.00% 0.07% 0.00% T: 26.12%
Aus  269 5.20% 0.40% 0.00% 0.00% T: 94.42%
Indica I  595 60.70% 36.10% 0.50% 0.00% T: 2.69%
Indica II  465 94.40% 1.70% 0.43% 0.00% T: 3.44%
Indica III  913 76.00% 0.00% 0.33% 0.00% T: 23.22%; CGGT: 0.44%
Indica Intermediate  786 77.00% 7.50% 0.25% 0.00% T: 15.27%
Temperate Japonica  767 0.10% 99.20% 0.00% 0.00% T: 0.65%
Tropical Japonica  504 5.20% 22.20% 0.20% 0.00% T: 72.42%
Japonica Intermediate  241 0.40% 89.20% 0.00% 0.00% T: 10.37%
VI/Aromatic  96 3.10% 0.00% 0.00% 0.00% T: 96.88%
Intermediate  90 22.20% 38.90% 3.33% 0.00% T: 35.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0129864706 C -> T LOC_Os01g51950.1 stop_gained ; p.Gln710*; HIGH stop_gained Average:39.569; most accessible tissue: Minghui63 young leaf, score: 63.571 N N N N
vg0129864706 C -> CCGGT LOC_Os01g51950.1 frameshift_variant ; p.Gln710fs; HIGH frameshift_variant Average:39.569; most accessible tissue: Minghui63 young leaf, score: 63.571 N N N N
vg0129864706 C -> CGGT LOC_Os01g51950.1 stop_gained&disruptive_inframe_insertion ; p.Gln710delinsArgTer; HIGH inframe_variant Average:39.569; most accessible tissue: Minghui63 young leaf, score: 63.571 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0129864706 NA 3.83E-06 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129864706 NA 1.26E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129864706 NA 4.53E-10 mr1190 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129864706 NA 1.68E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129864706 NA 3.09E-07 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129864706 NA 9.73E-11 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129864706 NA 1.57E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129864706 NA 1.57E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129864706 NA 6.05E-07 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129864706 NA 4.60E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129864706 NA 3.05E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129864706 NA 5.29E-16 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129864706 NA 3.12E-09 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129864706 NA 1.09E-06 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129864706 NA 5.73E-06 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129864706 NA 4.89E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129864706 NA 2.03E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129864706 NA 2.04E-06 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129864706 NA 5.80E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129864706 NA 6.15E-17 mr1539_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129864706 NA 9.00E-18 mr1540_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129864706 NA 6.67E-06 mr1545_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129864706 NA 7.32E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129864706 NA 4.96E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129864706 NA 6.99E-17 mr1732_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129864706 NA 2.88E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251