\
| Variant ID: vg0129861515 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 29861515 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 250. )
TCACTTTATATAAAATTGAAAACACATGAGATGAATGTTCTTTCTCGAAAAGTTGATTCTAAGTCGAGTGCTTTGGTTTCTTCTTCTTCCTCTTTGGATG[C/T]
TGATGCTTCTTCATCTAAGTCTTCTTTTCTTGCTGTTTTTAATGCCACATCCGATGATCAACTCGAACAAATCGAGGAGGAGGATTTGGCTTTGGTTGCT
AGCAACCAAAGCCAAATCCTCCTCCTCGATTTGTTCGAGTTGATCATCGGATGTGGCATTAAAAACAGCAAGAAAAGAAGACTTAGATGAAGAAGCATCA[G/A]
CATCCAAAGAGGAAGAAGAAGAAACCAAAGCACTCGACTTAGAATCAACTTTTCGAGAAAGAACATTCATCTCATGTGTTTTCAATTTTATATAAAGTGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.40% | 10.30% | 28.29% | 34.00% | NA |
| All Indica | 2759 | 6.50% | 5.50% | 34.87% | 53.17% | NA |
| All Japonica | 1512 | 71.40% | 1.30% | 20.17% | 7.21% | NA |
| Aus | 269 | 0.40% | 83.60% | 10.04% | 5.95% | NA |
| Indica I | 595 | 4.20% | 1.70% | 50.25% | 43.87% | NA |
| Indica II | 465 | 10.50% | 0.90% | 35.05% | 53.55% | NA |
| Indica III | 913 | 3.50% | 7.20% | 26.51% | 62.76% | NA |
| Indica Intermediate | 786 | 9.20% | 9.20% | 32.82% | 48.85% | NA |
| Temperate Japonica | 767 | 99.10% | 0.10% | 0.39% | 0.39% | NA |
| Tropical Japonica | 504 | 21.80% | 1.40% | 56.94% | 19.84% | NA |
| Japonica Intermediate | 241 | 86.70% | 4.60% | 6.22% | 2.49% | NA |
| VI/Aromatic | 96 | 3.10% | 78.10% | 15.62% | 3.12% | NA |
| Intermediate | 90 | 36.70% | 18.90% | 31.11% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0129861515 | C -> T | LOC_Os01g51950.1 | missense_variant ; p.Ala183Val; MODERATE | nonsynonymous_codon ; A183V | Average:14.312; most accessible tissue: Minghui63 young leaf, score: 20.156 | benign |
-0.674 |
TOLERATED | 1.00 |
| vg0129861515 | C -> DEL | LOC_Os01g51950.1 | N | frameshift_variant | Average:14.312; most accessible tissue: Minghui63 young leaf, score: 20.156 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0129861515 | NA | 2.17E-13 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129861515 | 6.46E-06 | NA | mr1083 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129861515 | NA | 5.26E-10 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129861515 | NA | 4.21E-07 | mr1584 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129861515 | 1.10E-06 | 5.72E-07 | mr1720 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129861515 | NA | 2.01E-14 | mr1740 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129861515 | NA | 4.03E-09 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129861515 | NA | 1.02E-06 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129861515 | NA | 4.67E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129861515 | NA | 6.94E-15 | mr1982 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129861515 | NA | 1.04E-06 | mr1097_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129861515 | NA | 1.60E-11 | mr1520_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129861515 | NA | 8.10E-15 | mr1539_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |