\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129848686:

Variant ID: vg0129848686 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 29848686
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATAGTAGGCTATAAGCCAGCTGTAAATATATTTTAAAAAAATAAATAAGGAGAGAGAAAAACAGCGGGCTACAGATTTGTAGCCACCTTTAGCATAGA[C/T]
TCTAAGACGTATTGTGTGTATAACAGGTGGGACCATGTATTAATAGTGTAGTATATAACTATTATATGAATGAGCTGCTAAATTGATTATAAATGAATTG

Reverse complement sequence

CAATTCATTTATAATCAATTTAGCAGCTCATTCATATAATAGTTATATACTACACTATTAATACATGGTCCCACCTGTTATACACACAATACGTCTTAGA[G/A]
TCTATGCTAAAGGTGGCTACAAATCTGTAGCCCGCTGTTTTTCTCTCTCCTTATTTATTTTTTTAAAATATATTTACAGCTGGCTTATAGCCTACTATTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.30% 9.20% 0.47% 0.00% NA
All Indica  2759 98.20% 1.00% 0.80% 0.00% NA
All Japonica  1512 74.70% 25.30% 0.00% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 98.80% 0.30% 0.84% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 98.80% 1.00% 0.22% 0.00% NA
Indica Intermediate  786 95.90% 2.20% 1.91% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 28.40% 71.60% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 6.60% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0129848686 C -> T LOC_Os01g51920.1 upstream_gene_variant ; 1861.0bp to feature; MODIFIER silent_mutation Average:98.802; most accessible tissue: Minghui63 young leaf, score: 99.736 N N N N
vg0129848686 C -> T LOC_Os01g51930.1 upstream_gene_variant ; 3566.0bp to feature; MODIFIER silent_mutation Average:98.802; most accessible tissue: Minghui63 young leaf, score: 99.736 N N N N
vg0129848686 C -> T LOC_Os01g51920-LOC_Os01g51930 intergenic_region ; MODIFIER silent_mutation Average:98.802; most accessible tissue: Minghui63 young leaf, score: 99.736 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0129848686 C T 0.0 0.04 0.03 -0.02 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0129848686 NA 3.53E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129848686 5.16E-06 2.63E-11 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129848686 NA 5.45E-11 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129848686 NA 1.69E-13 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129848686 NA 1.06E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129848686 NA 3.02E-06 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129848686 8.95E-07 6.20E-17 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129848686 NA 2.70E-13 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129848686 NA 1.88E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129848686 NA 5.02E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129848686 1.16E-08 NA mr1539_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129848686 NA 3.23E-17 mr1539_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129848686 2.16E-07 NA mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129848686 NA 9.80E-19 mr1540_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129848686 NA 2.87E-06 mr1715_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129848686 4.00E-07 NA mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129848686 NA 8.12E-17 mr1732_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251