Search for Variation information by Variation ID:
Detailed information for vg0129794216:
| Variant ID: vg0129794216 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 29794216 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
AAAGCTAAACCGAAAGATGAATATCCAATGCCAGTAGCCGTTCAGCTGGTTGATGCTACGTCAGGGAACAGAATTTTGAGTTTTATGGATGGAAACACAA[T/G]
GTATAATCAAATTTTTATGGCTGAAGAAGATATCCATAAGACAGCTTTTAGATGTCCTGGTGCAATCGTCTTATTTGAATGGGTTGTTATGACTTTCGGC
Reverse complement sequence
GCCGAAAGTCATAACAACCCATTCAAATAAGACGATTGCACCAGGACATCTAAAAGCTGTCTTATGGATATCTTCTTCAGCCATAAAAATTTGATTATAC[A/C]
TTGTGTTTCCATCCATAAAACTCAAAATTCTGTTCCCTGACGTAGCATCAACCAGCTGAACGGCTACTGGCATTGGATATTCATCTTTCGGTTTAGCTTT
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.30% | 22.20% | 0.47% | 6.01% | NA |
| All Indica | 2759 | 99.30% | 0.50% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 15.20% | 66.20% | 0.40% | 18.19% | NA |
| Aus | 269 | 95.90% | 0.40% | 3.35% | 0.37% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 1.10% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 9.00% | 90.50% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 28.40% | 19.40% | 0.79% | 51.39% | NA |
| Japonica Intermediate | 241 | 7.50% | 86.70% | 0.83% | 4.98% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 58.90% | 35.60% | 2.22% | 3.33% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0129794216 | T -> G | LOC_Os01g51820.1 | missense_variant ; p.Met1249Arg; MODERATE | nonsynonymous_codon ; M1249R | Average:24.166; most accessible tissue: Minghui63 flower, score: 32.19 | probably damaging  |
-2.03 |
DELETERIOUS | 0.03 |
| vg0129794216 | T -> DEL | LOC_Os01g51820.1 | N | frameshift_variant | Average:24.166; most accessible tissue: Minghui63 flower, score: 32.19 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0129794216 | NA | 2.78E-08 | mr1449 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129794216 | 4.82E-06 | NA | mr1522 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129794216 | NA | 9.39E-06 | mr1596 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129794216 | NA | 2.60E-06 | mr1704 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129794216 | NA | 1.44E-06 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129794216 | NA | 2.47E-06 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129794216 | NA | 2.32E-12 | mr1844 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129794216 | NA | 1.42E-12 | mr1520_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |