Variant ID: vg0129784098 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 29784098 |
Reference Allele: A | Alternative Allele: T |
Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, T: 0.07, others allele: 0.00, population size: 182. )
AACTAGTGTTTTTTGTGTAATAGTTCTTCACTTAGCGTGTCACCCGCTTGGTACATCTCCAGTATTGGCAACAAATTTGAAGCAGCAGCCAAAAACACAC[A/T]
TTTGTCATTACGAACCTGTGGAATATTGAAATACAGCTTAGATAAAATTCAGTAAAAGAACTCAGAGATGCAGTTAGTTTCCCATATCCTAATAATACAA
TTGTATTATTAGGATATGGGAAACTAACTGCATCTCTGAGTTCTTTTACTGAATTTTATCTAAGCTGTATTTCAATATTCCACAGGTTCGTAATGACAAA[T/A]
GTGTGTTTTTGGCTGCTGCTTCAAATTTGTTGCCAATACTGGAGATGTACCAAGCGGGTGACACGCTAAGTGAAGAACTATTACACAAAAAACACTAGTT
Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 88.00% | 12.00% | 0.02% | 0.00% | NA |
All Indica | 2759 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 80.60% | 19.40% | 0.00% | 0.00% | NA |
Aus | 269 | 55.00% | 45.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 46.80% | 53.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
Intermediate | 90 | 72.20% | 26.70% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0129784098 | A -> T | LOC_Os01g51800.1 | 3_prime_UTR_variant ; 1068.0bp to feature; MODIFIER | silent_mutation | Average:39.301; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
vg0129784098 | A -> T | LOC_Os01g51790.1 | downstream_gene_variant ; 950.0bp to feature; MODIFIER | silent_mutation | Average:39.301; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
vg0129784098 | A -> T | LOC_Os01g51810.1 | downstream_gene_variant ; 2037.0bp to feature; MODIFIER | silent_mutation | Average:39.301; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0129784098 | NA | 7.52E-06 | mr1072_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0129784098 | 2.36E-06 | NA | mr1124_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0129784098 | 4.14E-06 | 6.00E-07 | mr1124_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0129784098 | NA | 1.70E-06 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0129784098 | NA | 5.01E-06 | mr1438_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0129784098 | NA | 4.00E-08 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0129784098 | NA | 1.21E-07 | mr1815_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |