Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129767620:

Variant ID: vg0129767620 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 29767620
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

CTATGTTTTCATATATGTTAGTTTACCTTGCTCTTACCACAAAATGGAATGTACACAGTGCACATCCTCATCAATATCACAAGATTCTTTTTCATGCTAC[G/A]
ATAATAGGTATATATTGTAGGCTGCTAAGCTCCTATAATAACAAACTGGATTGGACAAATGCTACACCTGAATATCTGCAAATTGTCATGGGTTCCACCA

Reverse complement sequence

TGGTGGAACCCATGACAATTTGCAGATATTCAGGTGTAGCATTTGTCCAATCCAGTTTGTTATTATAGGAGCTTAGCAGCCTACAATATATACCTATTAT[C/T]
GTAGCATGAAAAAGAATCTTGTGATATTGATGAGGATGTGCACTGTGTACATTCCATTTTGTGGTAAGAGCAAGGTAAACTAACATATATGAAAACATAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.30%	6.30%	0.40%	0.00%	NA
All Indica	2759	90.70%	9.10%	0.14%	0.00%	NA
All Japonica	1512	96.20%	2.80%	0.99%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	65.40%	34.30%	0.34%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	94.10%	5.60%	0.25%	0.00%	NA
Temperate Japonica	767	93.50%	4.80%	1.69%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	1.70%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0129767620	G -> A	LOC_Os01g51770.1	downstream_gene_variant ; 2562.0bp to feature; MODIFIER	silent_mutation	Average:44.34; most accessible tissue: Callus, score: 71.249	N	N	N	N
vg0129767620	G -> A	LOC_Os01g51754.4	downstream_gene_variant ; 3678.0bp to feature; MODIFIER	silent_mutation	Average:44.34; most accessible tissue: Callus, score: 71.249	N	N	N	N
vg0129767620	G -> A	LOC_Os01g51754.3	downstream_gene_variant ; 1223.0bp to feature; MODIFIER	silent_mutation	Average:44.34; most accessible tissue: Callus, score: 71.249	N	N	N	N
vg0129767620	G -> A	LOC_Os01g51754.1	intron_variant ; MODIFIER	silent_mutation	Average:44.34; most accessible tissue: Callus, score: 71.249	N	N	N	N
vg0129767620	G -> A	LOC_Os01g51754.2	intron_variant ; MODIFIER	silent_mutation	Average:44.34; most accessible tissue: Callus, score: 71.249	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0129767620	NA	1.64E-06	mr1070	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129767620	NA	1.25E-07	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129767620	9.11E-07	NA	mr1522	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129767620	NA	1.15E-09	mr1839	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129767620	NA	2.84E-07	mr1909	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129767620	NA	3.87E-06	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129767620	NA	2.01E-06	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129767620	NA	8.31E-09	mr1758_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251