Variant ID: vg0129767620 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 29767620 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 277. )
CTATGTTTTCATATATGTTAGTTTACCTTGCTCTTACCACAAAATGGAATGTACACAGTGCACATCCTCATCAATATCACAAGATTCTTTTTCATGCTAC[G/A]
ATAATAGGTATATATTGTAGGCTGCTAAGCTCCTATAATAACAAACTGGATTGGACAAATGCTACACCTGAATATCTGCAAATTGTCATGGGTTCCACCA
TGGTGGAACCCATGACAATTTGCAGATATTCAGGTGTAGCATTTGTCCAATCCAGTTTGTTATTATAGGAGCTTAGCAGCCTACAATATATACCTATTAT[C/T]
GTAGCATGAAAAAGAATCTTGTGATATTGATGAGGATGTGCACTGTGTACATTCCATTTTGTGGTAAGAGCAAGGTAAACTAACATATATGAAAACATAG
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 93.30% | 6.30% | 0.40% | 0.00% | NA |
All Indica | 2759 | 90.70% | 9.10% | 0.14% | 0.00% | NA |
All Japonica | 1512 | 96.20% | 2.80% | 0.99% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 65.40% | 34.30% | 0.34% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 94.10% | 5.60% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 93.50% | 4.80% | 1.69% | 0.00% | NA |
Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 97.50% | 1.70% | 0.83% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0129767620 | G -> A | LOC_Os01g51770.1 | downstream_gene_variant ; 2562.0bp to feature; MODIFIER | silent_mutation | Average:44.34; most accessible tissue: Callus, score: 71.249 | N | N | N | N |
vg0129767620 | G -> A | LOC_Os01g51754.4 | downstream_gene_variant ; 3678.0bp to feature; MODIFIER | silent_mutation | Average:44.34; most accessible tissue: Callus, score: 71.249 | N | N | N | N |
vg0129767620 | G -> A | LOC_Os01g51754.3 | downstream_gene_variant ; 1223.0bp to feature; MODIFIER | silent_mutation | Average:44.34; most accessible tissue: Callus, score: 71.249 | N | N | N | N |
vg0129767620 | G -> A | LOC_Os01g51754.1 | intron_variant ; MODIFIER | silent_mutation | Average:44.34; most accessible tissue: Callus, score: 71.249 | N | N | N | N |
vg0129767620 | G -> A | LOC_Os01g51754.2 | intron_variant ; MODIFIER | silent_mutation | Average:44.34; most accessible tissue: Callus, score: 71.249 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0129767620 | NA | 1.64E-06 | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0129767620 | NA | 1.25E-07 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0129767620 | 9.11E-07 | NA | mr1522 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0129767620 | NA | 1.15E-09 | mr1839 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0129767620 | NA | 2.84E-07 | mr1909 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0129767620 | NA | 3.87E-06 | mr1128_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0129767620 | NA | 2.01E-06 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0129767620 | NA | 8.31E-09 | mr1758_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |