Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0129744626:

Variant ID: vg0129744626 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 29744626
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCGCTCAACCACGAAGCCACCGCACGCCCCCTTCGTCAAGGGATGGGCAAGGCGGGAGCCGGCCCACGGAGAGGACTACCCAAGCCTCGATCACTCGGG[A/G]
TAGTTCTTCCTTCACTCTGAAGGTGGTGAACTCCAAACCACTCACAAACGGCGTCGGGCCTCCTCCACAATCTCCTCGGAGAGGTCACCGAGCAACATCT

Reverse complement sequence

AGATGTTGCTCGGTGACCTCTCCGAGGAGATTGTGGAGGAGGCCCGACGCCGTTTGTGAGTGGTTTGGAGTTCACCACCTTCAGAGTGAAGGAAGAACTA[T/C]
CCCGAGTGATCGAGGCTTGGGTAGTCCTCTCCGTGGGCCGGCTCCCGCCTTGCCCATCCCTTGACGAAGGGGGCGTGCGGTGGCTTCGTGGTTGAGCGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.50% 20.80% 0.19% 6.50% NA
All Indica  2759 99.70% 0.10% 0.07% 0.18% NA
All Japonica  1512 17.60% 63.30% 0.46% 18.65% NA
Aus  269 96.30% 0.00% 0.00% 3.72% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 99.80% 0.00% 0.00% 0.22% NA
Indica Intermediate  786 99.40% 0.30% 0.00% 0.38% NA
Temperate Japonica  767 0.50% 99.00% 0.00% 0.52% NA
Tropical Japonica  504 42.70% 4.40% 0.60% 52.38% NA
Japonica Intermediate  241 19.50% 73.00% 1.66% 5.81% NA
VI/Aromatic  96 94.80% 0.00% 0.00% 5.21% NA
Intermediate  90 68.90% 25.60% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0129744626 A -> G LOC_Os01g51720.1 downstream_gene_variant ; 2099.0bp to feature; MODIFIER silent_mutation Average:45.563; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 N N N N
vg0129744626 A -> G LOC_Os01g51730.1 downstream_gene_variant ; 255.0bp to feature; MODIFIER silent_mutation Average:45.563; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 N N N N
vg0129744626 A -> G LOC_Os01g51730-LOC_Os01g51735 intergenic_region ; MODIFIER silent_mutation Average:45.563; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 N N N N
vg0129744626 A -> DEL N N silent_mutation Average:45.563; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0129744626 NA 8.23E-35 Grain_thickness All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0129744626 NA 4.79E-55 Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0129744626 NA 3.76E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 1.02E-52 mr1241 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 1.92E-87 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 5.86E-09 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 1.11E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 1.15E-39 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 1.63E-09 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 1.68E-07 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 1.27E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 5.66E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 1.08E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 8.11E-33 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 2.98E-54 mr1089_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 4.90E-06 mr1092_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 4.04E-53 mr1093_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 2.49E-08 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 2.12E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 4.12E-06 mr1152_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 3.00E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 9.99E-54 mr1235_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 2.51E-62 mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 2.74E-13 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 2.53E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 1.26E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 7.15E-37 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 1.40E-14 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 1.51E-101 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 9.56E-32 mr1423_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 5.84E-37 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 1.59E-37 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 5.61E-15 mr1539_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 4.93E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 1.97E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 4.14E-22 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 1.37E-06 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 5.47E-20 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 2.56E-16 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 1.84E-07 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 1.12E-13 mr1732_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 5.90E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 6.11E-40 mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 2.71E-43 mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 2.64E-34 mr1789_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 3.79E-13 mr1789_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 2.43E-40 mr1805_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 8.79E-12 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129744626 NA 1.83E-52 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251