\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129625707:

Variant ID: vg0129625707 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 29625707
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCCCACCTATTTTTAATAAATAAATTGCTGACTGGACTGCCACGCGTGCGCTACGTAGACCAAAACCACCGCTGATTGGGTCAAGGGGGGTAATTCATC[C/T]
GGTTTGCATAGTTGGGGGTGAAGAATGTCCGGTTTTGTGGTTCAAGGGGGTAATTCGGATGACCACGATAGTTTGGGGGTGGTAATTCGTACTTTTTCTT

Reverse complement sequence

AAGAAAAAGTACGAATTACCACCCCCAAACTATCGTGGTCATCCGAATTACCCCCTTGAACCACAAAACCGGACATTCTTCACCCCCAACTATGCAAACC[G/A]
GATGAATTACCCCCCTTGACCCAATCAGCGGTGGTTTTGGTCTACGTAGCGCACGCGTGGCAGTCCAGTCAGCAATTTATTTATTAAAAATAGGTGGGCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.70% 44.20% 0.06% 0.00% NA
All Indica  2759 88.90% 11.10% 0.07% 0.00% NA
All Japonica  1512 9.00% 90.90% 0.07% 0.00% NA
Aus  269 5.90% 94.10% 0.00% 0.00% NA
Indica I  595 96.80% 3.00% 0.17% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 82.10% 17.90% 0.00% 0.00% NA
Indica Intermediate  786 85.20% 14.60% 0.13% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 26.00% 74.00% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.30% 0.41% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 28.90% 71.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0129625707 C -> T LOC_Os01g51580.1 upstream_gene_variant ; 2551.0bp to feature; MODIFIER silent_mutation Average:50.461; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0129625707 C -> T LOC_Os01g51590.1 upstream_gene_variant ; 222.0bp to feature; MODIFIER silent_mutation Average:50.461; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0129625707 C -> T LOC_Os01g51570.1 downstream_gene_variant ; 3314.0bp to feature; MODIFIER silent_mutation Average:50.461; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0129625707 C -> T LOC_Os01g51590-LOC_Os01g51610 intergenic_region ; MODIFIER silent_mutation Average:50.461; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0129625707 NA 5.21E-14 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 3.73E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 3.10E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 1.01E-07 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 5.39E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 1.46E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 1.03E-18 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 4.08E-33 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 4.25E-15 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 1.11E-10 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 3.75E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 1.28E-09 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 4.40E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 1.80E-06 1.80E-06 mr1663 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 1.22E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 6.68E-08 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 4.06E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 5.06E-32 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 2.76E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 8.27E-06 4.39E-06 mr1759 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 3.20E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 1.27E-06 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 1.09E-13 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 1.30E-09 mr1836 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 8.19E-12 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 5.29E-08 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 8.27E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 2.82E-16 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 5.24E-23 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 1.18E-19 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 2.21E-19 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 2.77E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129625707 NA 3.68E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251