Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0129623631:

Variant ID: vg0129623631 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 29623631
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, A: 0.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

CATCAGCACCCAATCCGGGCTTGATCCACGTCGCCCCCGTCCGATCCGATCTTCTCCAGTCTCCACAAACGCGCCTCTTATTCAGAACTCCAACCGGCAC[C/A]
AACGAGCTCCAGCTGCCAGATCCGGCCACAAGAGCTCGAGGTCGGCTAAGTCCGGAAGGTAGGAAGAGGGCGGGGAGAGAGGAGAGCTCGAGGAGATTAC

Reverse complement sequence

GTAATCTCCTCGAGCTCTCCTCTCTCCCCGCCCTCTTCCTACCTTCCGGACTTAGCCGACCTCGAGCTCTTGTGGCCGGATCTGGCAGCTGGAGCTCGTT[G/T]
GTGCCGGTTGGAGTTCTGAATAAGAGGCGCGTTTGTGGAGACTGGAGAAGATCGGATCGGACGGGGGCGACGTGGATCAAGCCCGGATTGGGTGCTGATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.00%	4.70%	0.70%	2.58%	NA
All Indica	2759	98.20%	1.10%	0.11%	0.69%	NA
All Japonica	1512	99.40%	0.50%	0.00%	0.07%	NA
Aus	269	18.20%	40.50%	10.04%	31.23%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.00%	0.00%	0.22%	NA
Indica III	913	98.80%	0.90%	0.00%	0.33%	NA
Indica Intermediate	786	95.00%	2.70%	0.38%	1.91%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.00%	0.20%	NA
Japonica Intermediate	241	97.10%	2.90%	0.00%	0.00%	NA
VI/Aromatic	96	15.60%	67.70%	3.12%	13.54%	NA
Intermediate	90	83.30%	11.10%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0129623631	C -> A	LOC_Os01g51580.1	upstream_gene_variant ; 475.0bp to feature; MODIFIER	silent_mutation	Average:68.249; most accessible tissue: Minghui63 young leaf, score: 86.891	N	N	N	N
vg0129623631	C -> A	LOC_Os01g51570.1	downstream_gene_variant ; 1238.0bp to feature; MODIFIER	silent_mutation	Average:68.249; most accessible tissue: Minghui63 young leaf, score: 86.891	N	N	N	N
vg0129623631	C -> A	LOC_Os01g51590.1	downstream_gene_variant ; 853.0bp to feature; MODIFIER	silent_mutation	Average:68.249; most accessible tissue: Minghui63 young leaf, score: 86.891	N	N	N	N
vg0129623631	C -> A	LOC_Os01g51580-LOC_Os01g51590	intergenic_region ; MODIFIER	silent_mutation	Average:68.249; most accessible tissue: Minghui63 young leaf, score: 86.891	N	N	N	N
vg0129623631	C -> DEL	N	N	silent_mutation	Average:68.249; most accessible tissue: Minghui63 young leaf, score: 86.891	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0129623631	C	A	-0.04	0.0	0.02	0.0	-0.02	-0.05

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0129623631	3.83E-06	NA	mr1113	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129623631	1.43E-08	NA	mr1114	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129623631	3.78E-07	NA	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129623631	1.86E-07	NA	mr1123	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129623631	1.23E-08	NA	mr1242	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129623631	7.82E-06	NA	mr1496	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129623631	4.83E-06	NA	mr1858	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129623631	4.74E-06	NA	mr1859	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129623631	5.32E-06	NA	mr1917	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129623631	3.76E-07	NA	mr1936	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129623631	8.14E-06	NA	mr1113_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129623631	7.20E-06	NA	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129623631	6.74E-06	NA	mr1119_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129623631	9.38E-06	NA	mr1240_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129623631	2.19E-06	NA	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129623631	NA	9.13E-07	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251