Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129618796:

Variant ID: vg0129618796 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 29618796
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAAAAAATCATGCCCACCGTCTTTTTTAACTTGTCACGTATACCTTGGCACCAACGACCTCCATACTCTACAAATATCATAGGCCAGGGGCGGATCTAC[A/G]
GTAGAAGGGCCGGTGTCAGGCGACACCGACGACTTTCAGCAAAACCTATAACAAAACTGCTATCTATTTATTATAACACCAATGATCTAAACATAATTAG

Reverse complement sequence

CTAATTATGTTTAGATCATTGGTGTTATAATAAATAGATAGCAGTTTTGTTATAGGTTTTGCTGAAAGTCGTCGGTGTCGCCTGACACCGGCCCTTCTAC[T/C]
GTAGATCCGCCCCTGGCCTATGATATTTGTAGAGTATGGAGGTCGTTGGTGCCAAGGTATACGTGACAAGTTAAAAAAGACGGTGGGCATGATTTTTTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.70%	31.80%	0.49%	2.96%	NA
All Indica	2759	91.20%	3.20%	0.69%	4.93%	NA
All Japonica	1512	10.00%	89.80%	0.13%	0.07%	NA
Aus	269	96.30%	3.70%	0.00%	0.00%	NA
Indica I	595	97.30%	0.30%	0.17%	2.18%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	83.90%	6.60%	1.75%	7.78%	NA
Indica Intermediate	786	91.00%	2.20%	0.25%	6.62%	NA
Temperate Japonica	767	0.10%	99.70%	0.00%	0.13%	NA
Tropical Japonica	504	27.40%	72.40%	0.20%	0.00%	NA
Japonica Intermediate	241	5.00%	94.60%	0.41%	0.00%	NA
VI/Aromatic	96	92.70%	5.20%	1.04%	1.04%	NA
Intermediate	90	47.80%	48.90%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0129618796	A -> G	LOC_Os01g51570.1	upstream_gene_variant ; 2158.0bp to feature; MODIFIER	silent_mutation	Average:56.417; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0129618796	A -> G	LOC_Os01g51550.1	downstream_gene_variant ; 4140.0bp to feature; MODIFIER	silent_mutation	Average:56.417; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0129618796	A -> G	LOC_Os01g51560.1	downstream_gene_variant ; 1342.0bp to feature; MODIFIER	silent_mutation	Average:56.417; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0129618796	A -> G	LOC_Os01g51580.1	downstream_gene_variant ; 3618.0bp to feature; MODIFIER	silent_mutation	Average:56.417; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0129618796	A -> G	LOC_Os01g51560-LOC_Os01g51570	intergenic_region ; MODIFIER	silent_mutation	Average:56.417; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0129618796	A -> DEL	N	N	silent_mutation	Average:56.417; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0129618796	NA	2.53E-06	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129618796	5.78E-07	5.77E-07	mr1663	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129618796	NA	7.89E-10	mr1790	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129618796	3.36E-06	3.35E-06	mr1802	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129618796	NA	4.66E-07	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129618796	NA	1.56E-07	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129618796	NA	9.17E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129618796	NA	7.13E-18	mr1682_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129618796	NA	9.78E-12	mr1986_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251