\
| Variant ID: vg0129595210 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 29595210 |
| Reference Allele: G | Alternative Allele: C,T |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CTTGGACTTGTCTTGCGTTCAGTACCAGATCGGTAGATGAACATGGAAATTCATAAAACCGGCTGTGTACACATAAAGACAAAGACAGGTTTGCCCCTTA[G/C,T]
AATTTTATACTGGAATCTCATTAAGTGGGGAGGAGAATGAATCTACACCATTGAATTATTTATACTAGCAGTATATACTGGTAGTATAGTGTACCGTAAA
TTTACGGTACACTATACTACCAGTATATACTGCTAGTATAAATAATTCAATGGTGTAGATTCATTCTCCTCCCCACTTAATGAGATTCCAGTATAAAATT[C/G,A]
TAAGGGGCAAACCTGTCTTTGTCTTTATGTGTACACAGCCGGTTTTATGAATTTCCATGTTCATCTACCGATCTGGTACTGAACGCAAGACAAGTCCAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.70% | 0.50% | 1.27% | 38.28% | T: 0.25% |
| All Indica | 2759 | 46.60% | 0.60% | 1.99% | 50.38% | T: 0.40% |
| All Japonica | 1512 | 74.10% | 0.30% | 0.20% | 25.33% | NA |
| Aus | 269 | 95.50% | 0.00% | 0.00% | 4.09% | T: 0.37% |
| Indica I | 595 | 18.50% | 0.80% | 3.19% | 77.48% | NA |
| Indica II | 465 | 11.80% | 1.30% | 2.15% | 84.52% | T: 0.22% |
| Indica III | 913 | 81.10% | 0.30% | 0.77% | 17.52% | T: 0.33% |
| Indica Intermediate | 786 | 48.50% | 0.40% | 2.42% | 47.84% | T: 0.89% |
| Temperate Japonica | 767 | 99.30% | 0.00% | 0.00% | 0.65% | NA |
| Tropical Japonica | 504 | 26.80% | 1.00% | 0.60% | 71.63% | NA |
| Japonica Intermediate | 241 | 92.90% | 0.00% | 0.00% | 7.05% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 74.40% | 0.00% | 2.22% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0129595210 | G -> T | LOC_Os01g51490.1 | upstream_gene_variant ; 4867.0bp to feature; MODIFIER | silent_mutation | Average:15.763; most accessible tissue: Callus, score: 68.003 | N | N | N | N |
| vg0129595210 | G -> T | LOC_Os01g51500.1 | upstream_gene_variant ; 1863.0bp to feature; MODIFIER | silent_mutation | Average:15.763; most accessible tissue: Callus, score: 68.003 | N | N | N | N |
| vg0129595210 | G -> T | LOC_Os01g51510.1 | downstream_gene_variant ; 884.0bp to feature; MODIFIER | silent_mutation | Average:15.763; most accessible tissue: Callus, score: 68.003 | N | N | N | N |
| vg0129595210 | G -> T | LOC_Os01g51520.1 | downstream_gene_variant ; 2207.0bp to feature; MODIFIER | silent_mutation | Average:15.763; most accessible tissue: Callus, score: 68.003 | N | N | N | N |
| vg0129595210 | G -> T | LOC_Os01g51530.1 | downstream_gene_variant ; 3671.0bp to feature; MODIFIER | silent_mutation | Average:15.763; most accessible tissue: Callus, score: 68.003 | N | N | N | N |
| vg0129595210 | G -> T | LOC_Os01g51510-LOC_Os01g51520 | intergenic_region ; MODIFIER | silent_mutation | Average:15.763; most accessible tissue: Callus, score: 68.003 | N | N | N | N |
| vg0129595210 | G -> DEL | N | N | silent_mutation | Average:15.763; most accessible tissue: Callus, score: 68.003 | N | N | N | N |
| vg0129595210 | G -> C | LOC_Os01g51490.1 | upstream_gene_variant ; 4867.0bp to feature; MODIFIER | silent_mutation | Average:15.763; most accessible tissue: Callus, score: 68.003 | N | N | N | N |
| vg0129595210 | G -> C | LOC_Os01g51500.1 | upstream_gene_variant ; 1863.0bp to feature; MODIFIER | silent_mutation | Average:15.763; most accessible tissue: Callus, score: 68.003 | N | N | N | N |
| vg0129595210 | G -> C | LOC_Os01g51510.1 | downstream_gene_variant ; 884.0bp to feature; MODIFIER | silent_mutation | Average:15.763; most accessible tissue: Callus, score: 68.003 | N | N | N | N |
| vg0129595210 | G -> C | LOC_Os01g51520.1 | downstream_gene_variant ; 2207.0bp to feature; MODIFIER | silent_mutation | Average:15.763; most accessible tissue: Callus, score: 68.003 | N | N | N | N |
| vg0129595210 | G -> C | LOC_Os01g51530.1 | downstream_gene_variant ; 3671.0bp to feature; MODIFIER | silent_mutation | Average:15.763; most accessible tissue: Callus, score: 68.003 | N | N | N | N |
| vg0129595210 | G -> C | LOC_Os01g51510-LOC_Os01g51520 | intergenic_region ; MODIFIER | silent_mutation | Average:15.763; most accessible tissue: Callus, score: 68.003 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0129595210 | NA | 4.53E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129595210 | NA | 2.18E-06 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129595210 | NA | 3.74E-06 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129595210 | NA | 7.41E-11 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129595210 | NA | 3.62E-07 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129595210 | NA | 7.06E-06 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129595210 | NA | 1.73E-06 | mr1742 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129595210 | NA | 6.33E-06 | mr1043_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129595210 | NA | 7.41E-06 | mr1092_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129595210 | NA | 6.54E-08 | mr1097_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129595210 | NA | 2.82E-07 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129595210 | NA | 3.77E-08 | mr1250_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129595210 | NA | 1.59E-06 | mr1277_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129595210 | NA | 3.53E-06 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129595210 | NA | 3.69E-11 | mr1364_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129595210 | 9.04E-06 | 9.01E-06 | mr1473_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129595210 | NA | 7.12E-06 | mr1479_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129595210 | NA | 8.33E-08 | mr1502_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129595210 | NA | 6.18E-09 | mr1543_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129595210 | NA | 9.32E-06 | mr1596_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129595210 | 2.92E-06 | 2.91E-06 | mr1630_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129595210 | NA | 1.22E-06 | mr1680_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129595210 | NA | 2.83E-07 | mr1808_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129595210 | NA | 4.89E-06 | mr1896_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |