Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129595210:

Variant ID: vg0129595210 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 29595210
Reference Allele: G	Alternative Allele: C,T
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTGGACTTGTCTTGCGTTCAGTACCAGATCGGTAGATGAACATGGAAATTCATAAAACCGGCTGTGTACACATAAAGACAAAGACAGGTTTGCCCCTTA[G/C,T]
AATTTTATACTGGAATCTCATTAAGTGGGGAGGAGAATGAATCTACACCATTGAATTATTTATACTAGCAGTATATACTGGTAGTATAGTGTACCGTAAA

Reverse complement sequence

TTTACGGTACACTATACTACCAGTATATACTGCTAGTATAAATAATTCAATGGTGTAGATTCATTCTCCTCCCCACTTAATGAGATTCCAGTATAAAATT[C/G,A]
TAAGGGGCAAACCTGTCTTTGTCTTTATGTGTACACAGCCGGTTTTATGAATTTCCATGTTCATCTACCGATCTGGTACTGAACGCAAGACAAGTCCAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.70%	0.50%	1.27%	38.28%	T: 0.25%
All Indica	2759	46.60%	0.60%	1.99%	50.38%	T: 0.40%
All Japonica	1512	74.10%	0.30%	0.20%	25.33%	NA
Aus	269	95.50%	0.00%	0.00%	4.09%	T: 0.37%
Indica I	595	18.50%	0.80%	3.19%	77.48%	NA
Indica II	465	11.80%	1.30%	2.15%	84.52%	T: 0.22%
Indica III	913	81.10%	0.30%	0.77%	17.52%	T: 0.33%
Indica Intermediate	786	48.50%	0.40%	2.42%	47.84%	T: 0.89%
Temperate Japonica	767	99.30%	0.00%	0.00%	0.65%	NA
Tropical Japonica	504	26.80%	1.00%	0.60%	71.63%	NA
Japonica Intermediate	241	92.90%	0.00%	0.00%	7.05%	NA
VI/Aromatic	96	95.80%	0.00%	0.00%	4.17%	NA
Intermediate	90	74.40%	0.00%	2.22%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0129595210	G -> T	LOC_Os01g51490.1	upstream_gene_variant ; 4867.0bp to feature; MODIFIER	silent_mutation	Average:15.763; most accessible tissue: Callus, score: 68.003	N	N	N	N
vg0129595210	G -> T	LOC_Os01g51500.1	upstream_gene_variant ; 1863.0bp to feature; MODIFIER	silent_mutation	Average:15.763; most accessible tissue: Callus, score: 68.003	N	N	N	N
vg0129595210	G -> T	LOC_Os01g51510.1	downstream_gene_variant ; 884.0bp to feature; MODIFIER	silent_mutation	Average:15.763; most accessible tissue: Callus, score: 68.003	N	N	N	N
vg0129595210	G -> T	LOC_Os01g51520.1	downstream_gene_variant ; 2207.0bp to feature; MODIFIER	silent_mutation	Average:15.763; most accessible tissue: Callus, score: 68.003	N	N	N	N
vg0129595210	G -> T	LOC_Os01g51530.1	downstream_gene_variant ; 3671.0bp to feature; MODIFIER	silent_mutation	Average:15.763; most accessible tissue: Callus, score: 68.003	N	N	N	N
vg0129595210	G -> T	LOC_Os01g51510-LOC_Os01g51520	intergenic_region ; MODIFIER	silent_mutation	Average:15.763; most accessible tissue: Callus, score: 68.003	N	N	N	N
vg0129595210	G -> DEL	N	N	silent_mutation	Average:15.763; most accessible tissue: Callus, score: 68.003	N	N	N	N
vg0129595210	G -> C	LOC_Os01g51490.1	upstream_gene_variant ; 4867.0bp to feature; MODIFIER	silent_mutation	Average:15.763; most accessible tissue: Callus, score: 68.003	N	N	N	N
vg0129595210	G -> C	LOC_Os01g51500.1	upstream_gene_variant ; 1863.0bp to feature; MODIFIER	silent_mutation	Average:15.763; most accessible tissue: Callus, score: 68.003	N	N	N	N
vg0129595210	G -> C	LOC_Os01g51510.1	downstream_gene_variant ; 884.0bp to feature; MODIFIER	silent_mutation	Average:15.763; most accessible tissue: Callus, score: 68.003	N	N	N	N
vg0129595210	G -> C	LOC_Os01g51520.1	downstream_gene_variant ; 2207.0bp to feature; MODIFIER	silent_mutation	Average:15.763; most accessible tissue: Callus, score: 68.003	N	N	N	N
vg0129595210	G -> C	LOC_Os01g51530.1	downstream_gene_variant ; 3671.0bp to feature; MODIFIER	silent_mutation	Average:15.763; most accessible tissue: Callus, score: 68.003	N	N	N	N
vg0129595210	G -> C	LOC_Os01g51510-LOC_Os01g51520	intergenic_region ; MODIFIER	silent_mutation	Average:15.763; most accessible tissue: Callus, score: 68.003	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0129595210	NA	4.53E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129595210	NA	2.18E-06	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129595210	NA	3.74E-06	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129595210	NA	7.41E-11	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129595210	NA	3.62E-07	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129595210	NA	7.06E-06	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129595210	NA	1.73E-06	mr1742	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129595210	NA	6.33E-06	mr1043_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129595210	NA	7.41E-06	mr1092_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129595210	NA	6.54E-08	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129595210	NA	2.82E-07	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129595210	NA	3.77E-08	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129595210	NA	1.59E-06	mr1277_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129595210	NA	3.53E-06	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129595210	NA	3.69E-11	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129595210	9.04E-06	9.01E-06	mr1473_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129595210	NA	7.12E-06	mr1479_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129595210	NA	8.33E-08	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129595210	NA	6.18E-09	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129595210	NA	9.32E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129595210	2.92E-06	2.91E-06	mr1630_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129595210	NA	1.22E-06	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129595210	NA	2.83E-07	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129595210	NA	4.89E-06	mr1896_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251